ID: 946021923

View in Genome Browser
Species Human (GRCh38)
Location 2:216646226-216646248
Sequence CAGTGGAAGGGGAGGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 946
Summary {0: 1, 1: 0, 2: 6, 3: 92, 4: 847}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946021909_946021923 20 Left 946021909 2:216646183-216646205 CCTGGAATATCTGAGAGCAGAGT 0: 1
1: 0
2: 1
3: 14
4: 202
Right 946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG 0: 1
1: 0
2: 6
3: 92
4: 847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946021923 Original CRISPR CAGTGGAAGGGGAGGGTGGT GGG Intronic
900132446 1:1092811-1092833 CTCTGGAAGGTGGGGGTGGTCGG + Intronic
900291468 1:1925470-1925492 CAGGGCAGGGGGTGGGTGGTGGG + Intronic
900331281 1:2135923-2135945 CAGTGGAAGGGGAGGTGTCTGGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900421759 1:2558794-2558816 AAGTGGAATGGGATGGTGCTGGG + Intronic
900606956 1:3527990-3528012 CAGTGGCAGGGGGCTGTGGTGGG + Intronic
901203308 1:7479014-7479036 CAGTGGAAGACGTGGGCGGTGGG + Intronic
901630767 1:10647101-10647123 GAGGGGGAGGGGAGGCTGGTGGG + Intronic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902675177 1:18003637-18003659 TAGGGGAAGTTGAGGGTGGTAGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902837046 1:19054086-19054108 CAGTTAAAGGGGAGGGTGGCCGG - Intergenic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903284024 1:22266158-22266180 CAGGTGAGGGGGAGGGTGGGAGG + Intergenic
903664625 1:24998776-24998798 CAGGGGGAAGGGAGGGTGCTGGG - Intergenic
903872552 1:26447010-26447032 CAGTAGAAGGGGAGAGGGTTAGG + Intronic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904431733 1:30468753-30468775 CAGGGGAAGGGGAGAGAGGGTGG - Intergenic
904922909 1:34022719-34022741 AACTGGAAGGGGATGGAGGTAGG + Intronic
905348648 1:37328924-37328946 CAGGGGAAGGGGAGAGAGATGGG + Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905895407 1:41542663-41542685 CAGTGCAAGGGGATGATGGCAGG + Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
906151267 1:43588992-43589014 CAGTGAAAGGTGAGTGTGGCAGG + Exonic
906191969 1:43904746-43904768 CAGGAGGAGGGGAGAGTGGTGGG - Intronic
906495228 1:46301006-46301028 CAGTGGTAGGGGAGGGAGAAGGG + Intronic
906544203 1:46609967-46609989 CCTTGGTAGGGGAGGGTGGTAGG + Intronic
906725723 1:48042679-48042701 CGGGGGAAGGGGTGGGTGTTAGG + Intergenic
906972440 1:50530484-50530506 CAGAGGTTGGGAAGGGTGGTGGG + Intronic
907030332 1:51164698-51164720 CAGTGGCAGGGGTGGGTCATGGG + Intergenic
908295393 1:62707647-62707669 CATGGGAAGTGGAGGGTGGCAGG + Intergenic
908643361 1:66249661-66249683 CAGGGGGTGGGGCGGGTGGTGGG - Intronic
909194074 1:72593924-72593946 CAGTTGCAGGGCATGGTGGTGGG + Intergenic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
910545587 1:88413072-88413094 CAGGGGATGGGGAGGATGGTGGG + Intergenic
910624955 1:89296703-89296725 CATTGGCAGGGGAGGTTGGAGGG - Intergenic
910869454 1:91819384-91819406 CAGTGGAGTGGGATGATGGTCGG - Intronic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
912323762 1:108738652-108738674 CAGTGGAAGGGGGTGTGGGTGGG - Intronic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912665770 1:111578199-111578221 CGGTGGAAGGGGAGGATTGGTGG + Intronic
913381165 1:118211880-118211902 CAGAGGATGGGAAGGGTAGTGGG - Intergenic
914334084 1:146699423-146699445 GATTGGAAGAGGAGGGTGGAAGG + Intergenic
914754714 1:150556374-150556396 AAGTGGAAGGGGAGGCAGCTGGG - Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915107858 1:153545675-153545697 AAGGAGAAGGGGAGGCTGGTGGG - Intronic
915298788 1:154940401-154940423 GAGAGGAAGTGGAGGGTGGGGGG + Intergenic
915596681 1:156900313-156900335 CAGGAGAAGGGGATGGGGGTGGG - Intronic
915632419 1:157162749-157162771 AAATGGAAGGGGGTGGTGGTGGG + Intergenic
916006372 1:160664901-160664923 CAGAGGAAGTGGAGAGGGGTTGG - Intergenic
916007679 1:160677239-160677261 CAGTGGAAGAAGAGGGTTTTGGG - Intergenic
916016150 1:160751286-160751308 CAGTGGAAGTGGTGAGTGGTTGG + Intronic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916481856 1:165221404-165221426 CAGTGGCAGGGCAGGATAGTTGG - Intronic
916872668 1:168933990-168934012 CAGAGGAAAGGGCGGGAGGTCGG - Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917793020 1:178511969-178511991 CAGCGGAAGGAGAGGGAGTTGGG - Intergenic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
918591435 1:186245477-186245499 TGGTGGAAGGGGAGGGCTGTAGG - Intergenic
919723641 1:200866977-200866999 CGGGGGGCGGGGAGGGTGGTAGG - Intergenic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
920717040 1:208349839-208349861 CAGAGGAGGGGCTGGGTGGTGGG + Intergenic
921061940 1:211592544-211592566 CGGTGGAATCTGAGGGTGGTGGG - Intergenic
921070931 1:211656949-211656971 CATGGGAAGGGGAGGTTGGGTGG - Intergenic
921157793 1:212451918-212451940 CAGTGCAAGAGGTGGGAGGTGGG - Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922596585 1:226818461-226818483 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
922603629 1:226875121-226875143 CTGTGGTCCGGGAGGGTGGTAGG + Intronic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923109459 1:230879595-230879617 CAGAGGAGGGGCAGGGTGATTGG - Intergenic
923119794 1:230979136-230979158 CAGGGGAAGGGGAACGTGGATGG + Exonic
923226733 1:231944628-231944650 GAGTGGAAAGGGACTGTGGTGGG - Intronic
923532296 1:234821029-234821051 CCCTGGGAGGGGAGGATGGTGGG - Intergenic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
924049300 1:240064158-240064180 AAGTGGGAGGGGAGGGGAGTAGG + Intronic
924233990 1:241985409-241985431 AAGTGGGCGGGGTGGGTGGTGGG - Intergenic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1063004170 10:1952623-1952645 CAGAGGCCGGGGAGGGTGCTGGG - Intergenic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1064479506 10:15725410-15725432 CAGTGCAAAGGGTGGGGGGTGGG + Intergenic
1065764851 10:29019010-29019032 CAGAGGCTGGGGAGGGTAGTGGG + Intergenic
1065780461 10:29162054-29162076 CAGAGAAGGGGGAGGGTGGAGGG - Intergenic
1066271873 10:33831926-33831948 CAGTAGAAGGGTAGGGTGGGAGG + Intergenic
1066315439 10:34241391-34241413 CCGGTGGAGGGGAGGGTGGTGGG + Intronic
1067046413 10:42987756-42987778 CAGTGACAGGGGACGATGGTTGG - Intergenic
1067143144 10:43673032-43673054 CAGAGGAAGAGGTAGGTGGTTGG - Intergenic
1067462823 10:46470429-46470451 AAGTGGAAGGAGAGAGAGGTTGG - Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067624371 10:47914208-47914230 AAGTGGAAGGAGAGAGAGGTTGG + Intergenic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069356687 10:67594877-67594899 CATTGGAAAGGGTGGGAGGTGGG - Intronic
1069834111 10:71297833-71297855 CAGTCCAAGGGGAGGGAGGCTGG + Intronic
1069895338 10:71677047-71677069 CTGGTGAAGGGCAGGGTGGTTGG - Intronic
1069895515 10:71678141-71678163 CAGTGGATGGGTCGGGGGGTGGG - Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070508225 10:77135804-77135826 CGGTTGGAGGGAAGGGTGGTTGG + Intronic
1070548130 10:77469012-77469034 AAGTGGTCGGGGAGGGTGGTGGG - Intronic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1071038143 10:81272778-81272800 CAGAGGATGGGGAGTGTGGTGGG + Intergenic
1071553774 10:86586699-86586721 CAGTGGGCGGGGAGAGTGGCAGG + Intergenic
1072398780 10:95074370-95074392 CAGAGGATGGGAAGGGTAGTGGG + Intergenic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074838018 10:117317898-117317920 AACTGGAAAGGGAGGATGGTTGG - Intronic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075168542 10:120091620-120091642 AAGTGGATGGGCAGGGAGGTTGG + Intergenic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075724818 10:124605838-124605860 CAGTGGAGGGGGAGGGGGAAGGG + Intronic
1076365556 10:129919322-129919344 CAGTGGAGGCGGAGGCTGGGAGG + Intronic
1076734308 10:132451930-132451952 CTGTGGAAGAGCAGGGTGCTGGG + Intergenic
1076815620 10:132913362-132913384 AAGTGGGAGGGGCGGGTGGGCGG + Intronic
1076898506 10:133325695-133325717 AAGAGGAAGGGAAGGGTGGCGGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077420800 11:2449003-2449025 CAGGGGATCAGGAGGGTGGTAGG + Intronic
1079331892 11:19540556-19540578 CAGGGGATGGGGAGGGTTGGAGG - Intronic
1079625539 11:22612520-22612542 CTATGGATGGGGTGGGTGGTGGG + Intergenic
1079726556 11:23886840-23886862 AAGTTGAAGGGGCGGGGGGTGGG - Intergenic
1079839851 11:25382884-25382906 CACTGGAAGGGGAAGGCTGTGGG + Intergenic
1080236445 11:30074184-30074206 CAATGGACGGGGAAGGAGGTTGG - Intergenic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1080406211 11:31981711-31981733 CAGTGAAAAGGGAGGGTGTGGGG + Intronic
1080903271 11:36515630-36515652 CAGTGGAGGGGCAGGGCAGTGGG + Intronic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081763026 11:45590497-45590519 CAGGGGAGGTGGAGGGTGGGTGG - Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082784128 11:57307533-57307555 AAGTGGAAGGGGTTGGTGGTGGG - Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083594824 11:63914174-63914196 CAGTGAAAGGAGAGGCAGGTAGG + Intronic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083832434 11:65241489-65241511 CAGGGGAGGTTGAGGGTGGTGGG - Intergenic
1084398625 11:68931090-68931112 GAGTGGAAGGGGACAGTGGAAGG - Intronic
1084507967 11:69581486-69581508 CACTGGCAGCGGGGGGTGGTGGG + Intergenic
1084578448 11:70006443-70006465 CAGAGGTAGGGGAGGTGGGTGGG - Intergenic
1084587067 11:70068519-70068541 CAGTGGAAGGGGCTGGGAGTGGG + Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084954198 11:72682929-72682951 CAGGTGAAGGGGAGGCTGGGGGG - Intergenic
1085279185 11:75319266-75319288 CAGTGGAAGGGGAGGATCCTGGG - Intronic
1085281153 11:75331670-75331692 CAGTGGAGGGGGATAGGGGTGGG - Intronic
1085306306 11:75488020-75488042 GAATGGAAGGGGAGGCTGGATGG - Intronic
1085445385 11:76597703-76597725 CAGTGGCAGGGGAGCGGGGACGG + Intergenic
1085805481 11:79632122-79632144 CAGTGCAAGGGAGGGGTGCTCGG + Intergenic
1086761116 11:90632839-90632861 CAGGAGAATGGCAGGGTGGTGGG - Intergenic
1087177460 11:95108733-95108755 CAATGGAGGGGGAGGATGGTGGG - Intronic
1087884392 11:103460476-103460498 CAGTGGGTGGGGTGGGGGGTGGG + Intronic
1088078990 11:105886493-105886515 CAGAGGCAGGGAAGGGTAGTGGG - Intronic
1088111286 11:106265217-106265239 CAGAGGATGGGAAGGGTAGTGGG - Intergenic
1088352795 11:108909194-108909216 CCCTGGAAGGGAAGGGTGGCTGG + Intronic
1088597215 11:111449534-111449556 CATTTGAATGGGAGGGTGGAGGG - Intronic
1088953464 11:114594015-114594037 CAGAGGCTGGGAAGGGTGGTGGG + Intronic
1089160663 11:116434506-116434528 CAGTGGGAGGGGAGCATTGTTGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089608598 11:119656749-119656771 AGGCGGAAGGGGAGGGTGGCAGG - Intronic
1090022284 11:123138599-123138621 CAGGGGAGGGGGAGGGGGGTGGG - Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090691457 11:129187358-129187380 CAGAGGCTGGGAAGGGTGGTGGG + Intronic
1091184905 11:133638374-133638396 GAAGGGAAGGGGAAGGTGGTGGG - Intergenic
1091590004 12:1837227-1837249 CGGTGGGAGGGGAGGGCAGTTGG + Intronic
1091728880 12:2865166-2865188 CCATGGAAGGGGAGGGAAGTGGG + Intronic
1091779932 12:3207435-3207457 CAGTAGAAGTGGTGGGGGGTTGG + Intronic
1091883744 12:4001150-4001172 GAGTGAAAGGAGAGGGTGGGTGG - Intergenic
1091960689 12:4691718-4691740 CCCTGGAAGCAGAGGGTGGTGGG + Exonic
1092042282 12:5395439-5395461 GAGTGGAGAGGGAGGGTGTTGGG - Intergenic
1092057552 12:5520536-5520558 CAGTGGAAGGGTGGGGAGGGAGG + Intronic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093099271 12:15007875-15007897 CAGTGGAATGGGAAAGAGGTTGG + Intergenic
1093410528 12:18860003-18860025 CAAGGGAATGGGATGGTGGTAGG - Intergenic
1093934639 12:24987817-24987839 CAGTTATAGGGGAGGGAGGTGGG - Intergenic
1094380033 12:29832522-29832544 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095466259 12:42490685-42490707 CAGTGGAAGGGGTGGCAGGAGGG + Intronic
1095961067 12:47834744-47834766 GAGTGGATGGGGAGGGCGGTGGG - Intergenic
1096148416 12:49294539-49294561 CAGGGGAGGGGGAGGGGGGCTGG + Exonic
1096715280 12:53487349-53487371 CAAAGGAAGGAGAGGGTGTTCGG + Exonic
1097021063 12:56021139-56021161 CAGTGAAGGGGGTGGGTGGTGGG - Intronic
1097237233 12:57548930-57548952 AAGAGGAAGGGCAGGGTGGATGG - Intergenic
1097261030 12:57720365-57720387 CAGTGAGAGGAGAGGATGGTTGG - Intronic
1097466161 12:59927865-59927887 CCATGGAAGGGCAGGGCGGTGGG + Intergenic
1098565404 12:71929641-71929663 CAGAGGGTGGGAAGGGTGGTGGG + Intergenic
1098575366 12:72035907-72035929 CTGTGGAAAGGGAGTGTAGTGGG + Intronic
1099989362 12:89707857-89707879 CAGTGGCAGGGGTGTGGGGTGGG - Intronic
1101347922 12:103903645-103903667 CAGTGGAGGTGGAGGGTTTTGGG - Intergenic
1102229098 12:111250132-111250154 GAGTGGAAGGGAAAGGGGGTGGG - Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1102413626 12:112741575-112741597 CAGTGGAAGGGGATAGAGATGGG + Intronic
1102491461 12:113291826-113291848 CAGAGGCAGGGGAGGAGGGTGGG - Intronic
1102651204 12:114443828-114443850 CACTGGGAGGGGAGGGTCGCTGG + Intergenic
1102789706 12:115634789-115634811 CCGGGGATGGGGAGAGTGGTAGG - Intergenic
1102845041 12:116171567-116171589 CATTGCAAGAGGAAGGTGGTTGG - Intronic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103517153 12:121515115-121515137 CAGGGGATGGGGAGTGTGATTGG - Intronic
1103517220 12:121515315-121515337 CAGGGGATGGGGAGTGTGATTGG - Intronic
1103746992 12:123131681-123131703 CAGTGGAAGGTGTGGCTGGCTGG - Intronic
1103836941 12:123829178-123829200 AAGTTGAGGGGGAAGGTGGTTGG + Intronic
1104034249 12:125087535-125087557 GAGGGGAAAGGGAGGGAGGTCGG - Intronic
1104647121 12:130505530-130505552 GAGTGGAGGGGGTGGGGGGTGGG - Intronic
1104647215 12:130505760-130505782 GAGTGGAGGGGGTGGGGGGTGGG - Intronic
1104682728 12:130762433-130762455 GAGTGCCTGGGGAGGGTGGTCGG + Intergenic
1104711998 12:130993889-130993911 CAGGGTAAGGCGAGGGTGCTGGG - Intronic
1104784828 12:131442838-131442860 GAGTGGAAGGGGAGCGGGTTGGG + Intergenic
1104914234 12:132256587-132256609 CAGTGGAGGGGGACAGTGGAGGG + Intronic
1105007300 12:132729450-132729472 GAGGGGAATGGGAGGGTGGGAGG + Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105258203 13:18759292-18759314 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1105260860 13:18778592-18778614 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1105459052 13:20566980-20567002 CAGTGGAAGGGAGTGGCGGTGGG - Intergenic
1106133094 13:26955313-26955335 CAGTGGAAGGCGGGGTAGGTAGG + Intergenic
1106208029 13:27617636-27617658 TAGAGGAAGGGGAGGGTGAAGGG - Intronic
1106991924 13:35429768-35429790 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107186660 13:37530082-37530104 CTGTGGAAGGTGAGGGAGTTGGG + Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1108009249 13:45987144-45987166 CGGTGGAAGGATAGGGAGGTAGG - Intronic
1108084227 13:46768204-46768226 CAATGGAAGGGGGTGGTGGGGGG - Intergenic
1109157489 13:58928748-58928770 CAGGGGTTGGGGAGGGTGGGAGG + Intergenic
1109548535 13:63860798-63860820 CAGTGGGAGGGGTAGGTGGGTGG - Intergenic
1110816497 13:79866079-79866101 CAGTGAGAAGGAAGGGTGGTGGG + Intergenic
1111426346 13:88089246-88089268 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1111864663 13:93753733-93753755 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1111973905 13:94945866-94945888 CAGTGGAGGCGGAGGGGGGTTGG - Intergenic
1112512057 13:100018769-100018791 CAGAGGAAGGGCTGGGTGGGAGG + Intergenic
1112780001 13:102889989-102890011 TAGTGGTAGAGGTGGGTGGTAGG + Intergenic
1113261049 13:108563487-108563509 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1113554030 13:111216710-111216732 CAGTGGTAGGGAAGAGGGGTGGG + Intronic
1113794525 13:113049336-113049358 GTGGGGAAGGGGTGGGTGGTGGG + Intronic
1114517606 14:23309820-23309842 GAGTGGGAGAGGAGGGTGGCAGG - Exonic
1114712335 14:24791272-24791294 CAGAGGATGGGGAGGGTAGGGGG + Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1117478556 14:56119690-56119712 CAGTGAAAGGGGAGGGGGAAGGG + Intronic
1118078016 14:62323631-62323653 CAGAGGTTGGGAAGGGTGGTGGG - Intergenic
1118672423 14:68143763-68143785 CAGAGGAAGCGCAGGGTGGTTGG + Intronic
1118731607 14:68670692-68670714 CAGTGGAAGATGAGAGTGGATGG - Intronic
1118782431 14:69017811-69017833 GAGAGGCAGGGGAGGGTTGTGGG - Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118916341 14:70110338-70110360 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1119038535 14:71251415-71251437 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
1119473221 14:74911947-74911969 CAGTGGCAGGGCAGGGAGGGCGG + Intronic
1120238337 14:81918652-81918674 CAGAGGCTGGGAAGGGTGGTTGG + Intergenic
1120694884 14:87633457-87633479 AAGTGGAATGGGATGGTGGTGGG + Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121364764 14:93299094-93299116 CCTTGGAAGGGAAGGGAGGTGGG + Intronic
1121637829 14:95465753-95465775 CAGATGGATGGGAGGGTGGTTGG + Intronic
1121737043 14:96225895-96225917 GGGTGGGAGTGGAGGGTGGTGGG - Intronic
1121835429 14:97087973-97087995 GAGTGGTGGGGGAGGGTGGTGGG + Intergenic
1121882926 14:97516482-97516504 CTGAGGAGGGGGAGGGTTGTGGG - Intergenic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122135048 14:99627969-99627991 CAGTGGGAGGGGCGGCTGTTAGG + Intergenic
1122230716 14:100305388-100305410 CGGGGGCGGGGGAGGGTGGTTGG - Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122294522 14:100697829-100697851 GAGGGGTGGGGGAGGGTGGTAGG + Intergenic
1122302062 14:100736972-100736994 GATCGGAAGGGAAGGGTGGTGGG - Exonic
1122522050 14:102351639-102351661 CAATGTAATTGGAGGGTGGTTGG - Intronic
1122624653 14:103078195-103078217 CAGAGGAAGGGGAGGAAGGGAGG + Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122723287 14:103734334-103734356 CCGTGGCAGCGGAGGGTGGTTGG - Exonic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1202833838 14_GL000009v2_random:63074-63096 CAGTGGGAGGTGGGGGTGGGAGG + Intergenic
1123581532 15:21718941-21718963 CAGTGCAAGGTGTGGGTGGCAGG - Intergenic
1123618181 15:22161564-22161586 CAGTGCAAGGTGTGGGTGGCAGG - Intergenic
1123645297 15:22433505-22433527 CAGGGGACGGGGCAGGTGGTTGG + Intergenic
1123666565 15:22613146-22613168 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1123733014 15:23161839-23161861 CAGGGGACGGGGCAGGTGGTTGG - Intergenic
1123751143 15:23359216-23359238 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1123795085 15:23763143-23763165 CAGCCAAAGGGGAGGGTGGGGGG + Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1124118768 15:26870331-26870353 CAGAGGAAGGGGTGGGTGTGGGG + Intronic
1124283518 15:28383134-28383156 CAGGGGACGGGGCAGGTGGTTGG - Intronic
1124299180 15:28528479-28528501 CAGGGGACGGGGCAGGTGGTTGG + Intronic
1124320408 15:28707719-28707741 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1124334779 15:28848547-28848569 CATGGGGTGGGGAGGGTGGTGGG + Intergenic
1124482106 15:30087691-30087713 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124488564 15:30139791-30139813 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124543650 15:30608763-30608785 CAGGGGATGGGGCAGGTGGTTGG - Intronic
1124754964 15:32398531-32398553 CAGGGGATGGGGCAGGTGGTTGG + Intronic
1125196280 15:37050679-37050701 GAGTGGAGGGGCAGGGTGGAGGG - Intronic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1125627563 15:41121194-41121216 CAGTGGAATTGGTGGTTGGTGGG - Intergenic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126436902 15:48645864-48645886 GAGTGGAAAGGGAGGATGGATGG - Intergenic
1126682919 15:51220887-51220909 CAGAGGATGGGAAGGGTAGTGGG - Intronic
1126691028 15:51289085-51289107 TTGTGGAAGGACAGGGTGGTGGG + Intronic
1127198342 15:56614930-56614952 TGGTGGAAGGGGAGGGTGGCAGG - Intergenic
1127233661 15:57023827-57023849 CTGTGGATGGTGAGGGTTGTAGG + Intronic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128088983 15:64906130-64906152 CAGTGGACTGGCCGGGTGGTTGG + Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128186377 15:65646478-65646500 CAGGGGCTGGGGAGGGGGGTGGG - Intronic
1128335356 15:66782205-66782227 CAGTGGATAGGGATGGCGGTGGG + Exonic
1128506377 15:68275926-68275948 CAGAGGAGAGGGAGGGTGGTAGG + Intergenic
1128544503 15:68558067-68558089 CAGTGGAATGGCAGGGAGGGTGG + Intergenic
1128687619 15:69698543-69698565 AAGTGGAAGGGGCGGGTAATTGG + Intergenic
1128698235 15:69784946-69784968 CAGGGGAATGGCAGGGGGGTGGG + Intergenic
1129194270 15:73954845-73954867 CAGTTGAAGGGGAGAGGGGATGG - Intergenic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129229176 15:74187227-74187249 CAGTGGAGGGAGAGAGAGGTAGG - Intronic
1129272264 15:74425205-74425227 CGATGGAAGGGTTGGGTGGTAGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129442242 15:75589770-75589792 CAGAGGATGGGAAGGGTAGTGGG + Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129727500 15:77909106-77909128 CCGTGGCAGGGGAGGCGGGTGGG - Intergenic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130547189 15:84865298-84865320 CAGGGGAAGGAGAGGTTGCTGGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130857486 15:87853795-87853817 CAGTGGATGAGGAGGATGTTGGG + Intergenic
1130867486 15:87945072-87945094 CACTGGAAGGGGAGGCAGGGAGG + Intronic
1130878279 15:88032806-88032828 CCTGGGGAGGGGAGGGTGGTTGG - Intronic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1131370271 15:91875315-91875337 CAGTGGGAGGGGAGGGTCAGAGG - Intronic
1131808422 15:96147566-96147588 CAGTGGGAGGGCTGGGTGGTTGG - Intergenic
1132399289 15:101495722-101495744 AAGTGGAAAGGAAGGGAGGTAGG + Intronic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1132958446 16:2608999-2609021 CAATGGAAGGGAAGGGTGGTGGG + Intergenic
1132971058 16:2689095-2689117 CAATGGAAGGGAAGGGTGGTGGG + Intronic
1133036088 16:3035183-3035205 CACTGGACGGGGTGGGTGGGTGG - Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133229517 16:4359965-4359987 CAGGGGAGGGTGAGGGGGGTAGG - Intronic
1133257603 16:4526898-4526920 AGGTGGCAGGGCAGGGTGGTGGG - Intronic
1133272680 16:4618158-4618180 GGGTGGGAGGGTAGGGTGGTGGG + Intronic
1133501720 16:6372970-6372992 TAGTCGGATGGGAGGGTGGTTGG + Intronic
1134112648 16:11524756-11524778 CAGTGGAAGGGCTGGGTGGCTGG - Intergenic
1134449414 16:14354256-14354278 AAGGGGAAGGGGAGGGTAGGAGG + Intergenic
1135309206 16:21392120-21392142 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136148787 16:28332447-28332469 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136269820 16:29141820-29141842 CTGTGGCATGGGGGGGTGGTGGG + Intergenic
1136272963 16:29159238-29159260 CAGTGGGGTGGGGGGGTGGTGGG + Intergenic
1136305949 16:29371250-29371272 CACTGGCAGGGAAGGGTGGAGGG + Intergenic
1136409224 16:30066603-30066625 CAAGGGAGGGGGCGGGTGGTAGG - Intronic
1137306719 16:47207782-47207804 CTGTGGAAGGGGCGGGAGGGTGG - Intronic
1137862921 16:51864904-51864926 AAGTGGGAGGGGAGGAGGGTAGG + Intergenic
1137942491 16:52702603-52702625 CAGGGGAGGAGGAGGGTGGATGG - Intergenic
1138009186 16:53361988-53362010 CAGGGGATGGGGCAGGTGGTTGG + Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1139374488 16:66488213-66488235 CAGTGGTGGGGCAGGGGGGTGGG + Intronic
1139402972 16:66696732-66696754 CAGCGGAAAGGGAGGGAGGTGGG + Intergenic
1139999534 16:71011826-71011848 GATTGGAAGAGGAGGGTGGAAGG - Intronic
1140154756 16:72412456-72412478 CAGTAGAATTTGAGGGTGGTGGG - Intergenic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140550895 16:75864332-75864354 CAGAGGATGGGAAGGGTAGTGGG - Intergenic
1140792800 16:78408419-78408441 CAGTGGAGAGGGAATGTGGTGGG - Intronic
1141441888 16:84034449-84034471 CAGGCGAGTGGGAGGGTGGTTGG + Intronic
1141524796 16:84604307-84604329 CCGTGGGAGGGGAGCGTGGGTGG - Intronic
1141763976 16:86046593-86046615 AAGTGGCAGGGGAGGGGGCTGGG + Intergenic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1141997190 16:87643048-87643070 CAGGGGCTGGGGAGGGTTGTGGG - Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142861340 17:2763839-2763861 CAGTGGAAAGGGTGAGTGATGGG + Intergenic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143632293 17:8146209-8146231 AAGGGGAAGGGGATGGTGGTAGG + Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1143855176 17:9843026-9843048 GAGTCGAAGTGGGGGGTGGTGGG - Intronic
1144078128 17:11737322-11737344 CGGTGGGAGGGGTGGGTGGGGGG - Intronic
1144329448 17:14211120-14211142 CAGTGGCAGTGGAGGGGGGGTGG - Intergenic
1144447828 17:15347429-15347451 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447851 17:15347514-15347536 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1144447863 17:15347557-15347579 GAGTGGAAGGGGAGGGCTGATGG + Intergenic
1145116919 17:20218803-20218825 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1145367650 17:22278291-22278313 TTGTGGAAGGGCAGGGTGGGGGG + Intergenic
1145767837 17:27471562-27471584 CAGTGTCAGGGGAGGATGGTTGG + Intronic
1146028208 17:29341613-29341635 AAGTAGAGGGGGAGGGTGGTAGG + Intergenic
1146078728 17:29757770-29757792 CAGTGGCAGGGGTGGGGGGTGGG + Intronic
1146430387 17:32787741-32787763 GAGGGGAAAGGGAGGGAGGTGGG - Intronic
1147366508 17:39962908-39962930 AAGTGGAGTGGGAGGGGGGTGGG + Intergenic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1148647236 17:49225991-49226013 TTGTTGGAGGGGAGGGTGGTAGG + Intronic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148979577 17:51560746-51560768 CAGTGGAATGGGAGATTGGGAGG - Intergenic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1149247364 17:54726476-54726498 CAGAGGTTGGGGAGGGTAGTGGG + Intergenic
1149583572 17:57768701-57768723 CAGGGGAAGGAGAGTGGGGTGGG + Intergenic
1150010683 17:61499964-61499986 CAGTGGAAAAGGATGGTGCTGGG + Intergenic
1150147683 17:62782877-62782899 CAGAGGAAGGGCAGGGTGAGAGG - Intronic
1150719756 17:67604328-67604350 GATTAGAAGGGGAGGCTGGTAGG + Intronic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151166169 17:72205654-72205676 CCGTGGGAGGGGGTGGTGGTGGG - Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151672275 17:75577715-75577737 CAGGGCAAGGCGACGGTGGTAGG + Intergenic
1151694509 17:75707328-75707350 CAGAGGAAGGGTGGGGTGGCAGG - Exonic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1151896353 17:76983290-76983312 AAGTGGGAGGGGAGCGGGGTGGG - Intergenic
1151981735 17:77515292-77515314 CAGTGGCAAAGTAGGGTGGTAGG - Intergenic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152228413 17:79103076-79103098 CAGTGGCAGGGCTGGTTGGTTGG + Intronic
1152744920 17:82034110-82034132 CCCTGGAGGGGGAGGGTGGGGGG + Exonic
1152755385 17:82084980-82085002 CTGGGGATGGGGAGGCTGGTGGG + Intronic
1152800335 17:82327948-82327970 CGGTGGACGGGCAGGGTGGGGGG - Intronic
1152800365 17:82328018-82328040 TGGTGGACGGGCAGGGTGGTGGG - Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1152944266 17:83190642-83190664 CGGTGTCAGGGGAGGCTGGTGGG - Intergenic
1153457459 18:5296042-5296064 CACGGGAAGGGGGGGGCGGTGGG - Intronic
1154111936 18:11577692-11577714 AAGGGGAAGGGGAAGGTGGGAGG + Intergenic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1154433709 18:14327809-14327831 CAGTGGGAGGTGGGGGTGGGTGG + Intergenic
1156546540 18:37969247-37969269 CAGTGGCAGGGCTGGGAGGTTGG + Intergenic
1157211186 18:45743376-45743398 CAAAGGAAGGTGAGTGTGGTAGG - Intronic
1157260393 18:46171724-46171746 CAGTGGAAGGCCAGGATGGAGGG + Intergenic
1157392182 18:47312029-47312051 CATTGGAAAGTGAGGGAGGTTGG + Intergenic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157556855 18:48618540-48618562 CAGAGGAAGGGGAGGGTCCCTGG + Intronic
1157689407 18:49668824-49668846 AAGTGGCAGGGGTGGGTGGGTGG + Intergenic
1158737840 18:60104046-60104068 AAGTGGATGGGGTGGGTGATGGG + Intergenic
1158964390 18:62610627-62610649 TGGAGGAAGGGGAGGCTGGTGGG - Intergenic
1159211864 18:65333470-65333492 TGGTGGAAGGGGCGGTTGGTTGG - Intergenic
1159449593 18:68583402-68583424 CACTGGTAGGGGAGGGTGGTAGG + Intergenic
1159732850 18:72053322-72053344 CAAGGGAGGGTGAGGGTGGTGGG + Intergenic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160300334 18:77672357-77672379 AGGTGGAAGGGGAGGGCTGTAGG + Intergenic
1160395086 18:78564826-78564848 CAGTGGCGGGGGTGGGGGGTGGG - Intergenic
1160565520 18:79784557-79784579 CAGTGGGAGGGAAGAGGGGTTGG - Intergenic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161650460 19:5481041-5481063 CAGGGGCTGGGGAGGGGGGTGGG - Intergenic
1161782000 19:6299026-6299048 CAGGAGCAGGGGAGGGTGCTGGG + Intergenic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1162144805 19:8607094-8607116 CACTTGAAGGGGGGGCTGGTCGG + Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162378348 19:10317827-10317849 CAGTGGCAGGGGGGCGGGGTGGG - Intronic
1162730527 19:12715786-12715808 CAGTGGGAGGGGGAGGTGCTAGG - Intronic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163107304 19:15132364-15132386 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1163136822 19:15317592-15317614 CAATGGGAGTGGGGGGTGGTGGG + Intronic
1163357751 19:16825381-16825403 CAGTGGAAGTAGAGAGCGGTGGG - Intergenic
1163428157 19:17250413-17250435 CGCTGGAAGGGGTGGGTGGCTGG + Exonic
1163764654 19:19156061-19156083 GAGTAGAAGGGGAGGGAGGTGGG + Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164081390 19:21864619-21864641 CAGAGGCAGGGAAGGGTAGTGGG - Intergenic
1164521073 19:28980392-28980414 CAGTGGTGGGGCAGTGTGGTTGG - Intergenic
1164647459 19:29870179-29870201 CAGTGGGAGGGCCGGGGGGTGGG - Intergenic
1164694578 19:30233756-30233778 CAATGGGAGGGGTAGGTGGTGGG + Intronic
1164821719 19:31255977-31255999 CACTGGAAGCGGAGGGGTGTGGG + Intergenic
1165159671 19:33808628-33808650 CAGTGGAAGGGGTGTGTGCAGGG + Intronic
1165244875 19:34493127-34493149 CAGTGCCAGGGGTGGGAGGTGGG + Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1165811533 19:38614568-38614590 CAGTGGGAGGGGGAGATGGTGGG + Intronic
1166389170 19:42399501-42399523 CAGTGGAAGGCAAGGCTGGCGGG - Intergenic
1166558407 19:43716687-43716709 CAGAGGATGGGGTGAGTGGTAGG + Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167144344 19:47672947-47672969 CCAAGGAAGGGGAGGGTGGTGGG - Intronic
1167494364 19:49809080-49809102 CGCTGGCAGGGCAGGGTGGTGGG + Intronic
1167562686 19:50235402-50235424 TAGTGGAAGGGTAGGGAGCTGGG - Intronic
1167649967 19:50723777-50723799 CAGAGGAGTGGGAGGGTGATGGG + Intronic
1167697233 19:51022502-51022524 AAGTGGAAATGGAGGGTGATGGG + Exonic
1167728225 19:51233720-51233742 CAGTGGCACTGGAGGTTGGTTGG + Intronic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167898626 19:52601679-52601701 CCGTCGAAGGCGAGGGTGGGAGG - Intronic
1168294203 19:55370663-55370685 AAGGGAAAGGGGGGGGTGGTCGG + Intergenic
1168383093 19:55940812-55940834 CAGAGGCTGGGGAGGGTTGTGGG - Intergenic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
1202637199 1_KI270706v1_random:52803-52825 GAGTGAAAGGTGAGGGTGGGGGG - Intergenic
925228628 2:2209397-2209419 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
925283439 2:2700941-2700963 GAGGGGAAGGGGAGGATGGAGGG - Intergenic
925424533 2:3737582-3737604 CAGGGGAAGGTCTGGGTGGTTGG + Intronic
925921514 2:8641145-8641167 CAGAGGAAAGGGAGGCTGTTAGG + Intergenic
926385503 2:12332080-12332102 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
927168692 2:20350717-20350739 GGGTGGGGGGGGAGGGTGGTAGG - Intronic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927850819 2:26498234-26498256 CAGTAGAGGCGGAGGGTGGAGGG + Intronic
927884367 2:26709603-26709625 CGAGGGAAGGGGAGGGTGGTGGG + Intronic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928261754 2:29774281-29774303 TCTTGGCAGGGGAGGGTGGTTGG - Intronic
928836377 2:35551724-35551746 CAGGGGAAGGGCATGGTGGGAGG - Intergenic
929489361 2:42382687-42382709 CAGTTGAAGGGCAGAATGGTGGG - Intronic
929542240 2:42831280-42831302 CTGGGGAAGGGGCTGGTGGTGGG + Intergenic
929890594 2:45915830-45915852 CAGTGGGAGAGGAGGATGCTTGG - Intronic
929916618 2:46142141-46142163 CAGTGGAGGTGGAAGGTGGTAGG - Intronic
930031476 2:47060729-47060751 CAGTGGGAGGTGTGAGTGGTGGG - Intronic
930501241 2:52220843-52220865 CAGTGGAAGGTGGGGATTGTAGG + Intergenic
930774540 2:55159273-55159295 CAGTGGAAGTGGAGGGGGCAAGG - Intergenic
931658100 2:64528570-64528592 CAGTAGTAAGGGAGGTTGGTGGG + Intronic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
931777650 2:65554163-65554185 CAGTTGAGGTGGAGAGTGGTAGG + Intergenic
932002242 2:67895667-67895689 CAGAGGAAGGGGTTGGGGGTTGG - Intergenic
932476999 2:72012685-72012707 CAGTGGGAGGGGTGGGTTGGTGG + Intergenic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
932930308 2:76028760-76028782 CAGAGGCTGGGGATGGTGGTGGG - Intergenic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934077973 2:88443801-88443823 CGGGGGATGGAGAGGGTGGTGGG + Intergenic
934247821 2:90323410-90323432 CAGTGGCGGGGGGGGGTGGGGGG + Intergenic
934492954 2:94774703-94774725 CAGTGGGGGGTGGGGGTGGTGGG - Intergenic
934494300 2:94784142-94784164 CAGTGGGAGGTGGGGGTGGGAGG - Intergenic
934556501 2:95289559-95289581 CACGGGAAGGGGAGTGGGGTTGG - Exonic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
934949163 2:98564545-98564567 CAGAGGAAGGGGGCGGTGGGGGG + Intronic
935032511 2:99336397-99336419 CAGAGGAAGGGGCGGGCGGTCGG + Exonic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936064081 2:109317454-109317476 CAGGGGAAGAGCAGGGTGGGGGG - Intronic
936795343 2:116196536-116196558 CAGCGGAATGGGAGGGGGGCAGG - Intergenic
936994260 2:118397026-118397048 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
937132465 2:119523893-119523915 CAGAGGAAGGGGTCGGTGGTGGG + Intronic
937195952 2:120156492-120156514 CAGTGGCAGGGCAGGGTGCATGG - Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
938098089 2:128476071-128476093 CAGGGGATGGGGAGGGAGCTGGG + Intergenic
938111796 2:128572751-128572773 CAGAGGAAGGTGGGGGTGCTGGG + Intergenic
938261104 2:129895645-129895667 CTGTGGAAGGAGAGATTGGTGGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
939178660 2:138780406-138780428 CAGGGAAGGGGGAGGGTGGGCGG + Intergenic
939883076 2:147651892-147651914 AAGTGGAAGGGGAGAGGGGCAGG + Intergenic
940722581 2:157298375-157298397 TGGTGGAAGGGGAGGGCTGTAGG - Intronic
940901663 2:159131507-159131529 CAGGGGAAGGGGCGGGGGGAGGG - Intronic
942405852 2:175653966-175653988 CAGTGGAAAGGGTGGGAGGGGGG + Intergenic
942726129 2:179009661-179009683 GAGTGGCAGGGGTGGGGGGTGGG + Intronic
943060387 2:183037636-183037658 CATAGGAAAGGGAGGGTGGTGGG - Intronic
943769916 2:191705223-191705245 GAGTGGGAGAGGAAGGTGGTGGG + Intergenic
944955848 2:204807828-204807850 CAGTGGTTGGGAAGGGTTGTGGG + Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946281865 2:218671760-218671782 CTGGGGAACGGGAGGGTGGAGGG - Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946313517 2:218895757-218895779 CAGAGAGAGGGGTGGGTGGTTGG + Intronic
946355572 2:219182374-219182396 GAATGGAAGGGGAGGGGGCTGGG - Exonic
946418047 2:219550402-219550424 CAGTGGCAGGAGATGGGGGTGGG + Exonic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946520508 2:220459192-220459214 CAGTGGAGGTGGCGGTTGGTGGG + Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947735333 2:232451732-232451754 CAGTGGCAGGGGTGGCTGGCAGG - Intergenic
947830192 2:233134157-233134179 AGGAGGAAGGAGAGGGTGGTGGG + Intronic
948120723 2:235528360-235528382 CAGTGGGAGGGGAGGGGGCGGGG - Intronic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
1168854165 20:997239-997261 CAGTGGCTGGGCAGGGGGGTTGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169526845 20:6437676-6437698 AAGTGGATGGGGAGCGAGGTTGG + Intergenic
1169740259 20:8885757-8885779 CAGAGGCTGGGGAGGGTAGTTGG - Intronic
1170155261 20:13263336-13263358 GAGTGGAAGCAGGGGGTGGTGGG - Intronic
1170569704 20:17625781-17625803 CGGGGGGAGGGGAGGGTGTTGGG - Intronic
1170836536 20:19889338-19889360 CAGTGGCAGAGGTGGGAGGTGGG + Intronic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171884026 20:30638929-30638951 CAGTGAGAGGTGTGGGTGGTAGG - Intergenic
1172693213 20:36804515-36804537 CAGAGGAAGGGAAGGAAGGTGGG - Intronic
1172757836 20:37299707-37299729 CAGGGGAAGAGGAGGGTGACAGG + Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173210526 20:41028601-41028623 GAGAGGAAGGGGAGGCTGCTTGG + Intergenic
1173250112 20:41359922-41359944 CAGTGGGAGGAGAGGTTGCTGGG - Exonic
1173324171 20:42017494-42017516 CAGAGGGAGAGGAGGCTGGTGGG - Intergenic
1173586523 20:44187052-44187074 CAGTGAAAGGGTGGGGTGGAGGG + Exonic
1173645771 20:44632238-44632260 CATTGGAAGTGCAGGGTGGCTGG + Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173833871 20:46112485-46112507 CAGTGGCGGGGGAGGTGGGTGGG + Intergenic
1173942846 20:46926710-46926732 AAGTGGCTGTGGAGGGTGGTAGG + Intronic
1174141043 20:48413759-48413781 CAGTGGCAGGTGGGGGAGGTAGG + Intergenic
1174179530 20:48666128-48666150 AACGGGAAGGGGAGGGAGGTGGG + Intronic
1174956442 20:55103842-55103864 CAGGGGAAGGGGTGGGGTGTAGG + Intergenic
1175378955 20:58549364-58549386 CAGAGGAAGGGAAGGGGGGAAGG - Intergenic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175583856 20:60121856-60121878 AAGTTGAAAGGCAGGGTGGTGGG - Intergenic
1175631644 20:60543898-60543920 CAGAGGATGGGAAGGGTAGTCGG - Intergenic
1175895137 20:62332764-62332786 GAGTGGGAGGGGAGGGAGGTGGG - Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1175933330 20:62503624-62503646 GAGGGGAAGGGGAGGCTGGTGGG + Intergenic
1176139487 20:63538709-63538731 CAGGGGGAGGGGTGGGGGGTGGG + Intergenic
1176161285 20:63650212-63650234 CAGTGAAGGGGAAGGATGGTGGG - Intronic
1176168692 20:63687543-63687565 CAGTGGGTGGAGAGGGTGATGGG + Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176844202 21:13864316-13864338 CAGTGGGGGGTGGGGGTGGTAGG - Intergenic
1176939307 21:14904523-14904545 CAGAGGCTGGGAAGGGTGGTAGG - Intergenic
1177408923 21:20705132-20705154 CAGTGGAAGGCATGGGTGGGGGG - Intergenic
1178091292 21:29166161-29166183 CAGAGGTTGGGGAGGGTGGTAGG - Intronic
1178674147 21:34616425-34616447 GAATGGAATGGGAGGCTGGTTGG - Intergenic
1179649526 21:42798423-42798445 GGGTGGGAGGGGAGGGTGGGGGG + Intergenic
1179947632 21:44688820-44688842 CAGCGGAAGGGGAGTGGGGAGGG + Intronic
1180018573 21:45104143-45104165 AAGTGGAAGGAGAGGGTAGCAGG - Intronic
1180024811 21:45154965-45154987 CAGTGGGAGGGGAGAGAGATGGG + Intronic
1181051320 22:20239518-20239540 CAGTGGCAGGGGTGGGGAGTTGG - Intergenic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1181997912 22:26897630-26897652 GAGTGGGAAGGGAGGCTGGTGGG + Intergenic
1182047422 22:27286269-27286291 CAGTGAACGGGGATTGTGGTAGG - Intergenic
1182211956 22:28684160-28684182 CAGTGGTGGGGGTGGGGGGTAGG + Intergenic
1182772293 22:32804287-32804309 CTGTGCAAGGCGAGGGAGGTCGG - Intronic
1183112650 22:35662161-35662183 CTTTGGAAGGGAAGGGAGGTGGG + Exonic
1183516944 22:38272440-38272462 CAGTGACCTGGGAGGGTGGTCGG - Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1183804956 22:40200876-40200898 CAGTGGAATGTGATGGTGGTGGG + Intronic
1184084414 22:42251047-42251069 TATTGGAAGTGGAGGCTGGTAGG - Intronic
1184425915 22:44409256-44409278 GAGTGGACGGCGAGGGAGGTGGG + Intergenic
1184732774 22:46379919-46379941 CACTGGAACGGGGGTGTGGTGGG - Intronic
1185093453 22:48790772-48790794 GATTGGAAGGGGAGGGAGGAGGG - Intronic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185380793 22:50506720-50506742 TAGAGGCAGGGGTGGGTGGTGGG + Intronic
949414104 3:3798704-3798726 CCGAGGAAGGGGAGGAGGGTGGG - Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949509358 3:4754779-4754801 AAGTGGAAGGGGACTGTGGTAGG - Intronic
949970038 3:9396886-9396908 CGAAGGAAGGGGAGGGTGGGAGG + Intergenic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950867170 3:16198495-16198517 CAGTGGAAGGGGAGAATGAATGG + Intronic
951705196 3:25537180-25537202 TAGTGGAAGGGAAGGGAGGTTGG + Intronic
951904895 3:27695382-27695404 CAGTGGCTGGGAAGGGTAGTGGG + Intergenic
952385703 3:32840222-32840244 CTTTGGAAGGGAAGGGGGGTGGG - Intronic
952529079 3:34244545-34244567 CTGTGGAAGGCGAGGGTTGTGGG - Intergenic
952640134 3:35583813-35583835 CAGTGGCTGGGAAGGGTGCTAGG + Intergenic
953133292 3:40161400-40161422 GAGAGGATGGGGAGGGTCGTGGG - Intronic
953472292 3:43177586-43177608 GAGTGGAAAGGGAGCGAGGTGGG + Intergenic
954108845 3:48423235-48423257 CGGTGGATTGGGAGGGTGTTTGG - Intronic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
954940906 3:54372313-54372335 CAGTGAAAGAAGAGGGTGGGTGG + Intronic
955028530 3:55193572-55193594 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
955942263 3:64157751-64157773 GAGTGGCTGGGGAGGGAGGTGGG + Intronic
956035334 3:65084665-65084687 CAGTGGTGGGGGTGGGGGGTGGG - Intergenic
956659684 3:71584563-71584585 CAGTTGAAGGAGAGCGGGGTGGG + Intergenic
957873908 3:86120392-86120414 GAGTGGAAGGGTAGGGGAGTTGG - Intergenic
958536030 3:95404751-95404773 GGGTGGAAGGGGAGGGTTGGAGG + Intergenic
959499801 3:107093014-107093036 GAGTGGAAGGACAGGCTGGTAGG + Intergenic
960332593 3:116380514-116380536 CAGTGGCAGGGGAGTGGGGTAGG - Intronic
961384205 3:126515483-126515505 GAGTGGAAGGGGTAGGTGGTAGG - Intronic
961521292 3:127468743-127468765 CAGGTGTAGGGGAGGGTGCTGGG + Intergenic
961607964 3:128111524-128111546 CAGTGGAAGTGCAAAGTGGTTGG - Intronic
962126371 3:132623996-132624018 CGGGGGTGGGGGAGGGTGGTGGG - Intronic
962345677 3:134617727-134617749 CAAAGGAAGGGGAAGGTTGTGGG + Intronic
962468602 3:135684880-135684902 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
962818152 3:139020751-139020773 CGGTGGTAGGGGAGGCTGGTTGG + Exonic
962834414 3:139174376-139174398 GAGTGGAATCGGAGGGTGGTAGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963703323 3:148654426-148654448 CTTTGACAGGGGAGGGTGGTAGG - Intergenic
964365757 3:155949430-155949452 GGGAGGAAGGGGATGGTGGTGGG + Intergenic
964749623 3:160042323-160042345 CAGTGGAATGGGAGTGGGGAGGG + Intergenic
964759609 3:160122305-160122327 CAGAGGCTGGTGAGGGTGGTAGG + Intergenic
965098170 3:164260769-164260791 CAGAGGATGGGAAGGGTAGTGGG + Intergenic
965531257 3:169773000-169773022 CCGAGGAAGGGGAGGATGATGGG + Exonic
965578754 3:170245134-170245156 CAGTTGTAGGGGTGGGTGGTTGG + Intronic
965731288 3:171774791-171774813 AGGAGGAAGGGCAGGGTGGTGGG + Intronic
966657313 3:182374140-182374162 CAGTGGAAGTGGAGGTTGGGAGG + Intergenic
966852906 3:184175479-184175501 CAGAGTAATGAGAGGGTGGTAGG - Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
967277844 3:187794186-187794208 CATTGGAAGGGGAGAGTGAGTGG + Intergenic
967460934 3:189744746-189744768 CAGTGGAAAGGTAGGTGGGTAGG - Intronic
967681391 3:192368091-192368113 TTTTGGAAGGGGAGGGAGGTGGG - Intronic
968133772 3:196207795-196207817 CAGGGGACGGGGCGGGTGGGCGG - Intronic
968562972 4:1294783-1294805 CAGTGGCAGGGGACGGGGGTGGG + Intronic
968599496 4:1502402-1502424 CAGTGGGAGGGGAGGGGCATGGG - Intergenic
968761786 4:2446082-2446104 GAGGGGAAGGGGATGGTGCTGGG + Intronic
968952006 4:3700217-3700239 GAGTGGAGGGGGAGGGGGGGAGG + Intergenic
969046608 4:4340993-4341015 TAGTGGCGGGGGTGGGTGGTTGG + Intergenic
969080434 4:4613730-4613752 CAGTGGAAGGAAACAGTGGTGGG - Intergenic
969348212 4:6582219-6582241 CAGTGGGAAGGGAGTGGGGTTGG - Intronic
969692171 4:8709788-8709810 GTGTGGAAGGGGAGGGCTGTGGG - Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
969724346 4:8910506-8910528 CAGTGGCAGGGGTGGGGGGGCGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970538163 4:17051153-17051175 AAGAGGAGGGGGAGGGAGGTGGG + Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
971327914 4:25658923-25658945 GAGCAGGAGGGGAGGGTGGTGGG - Intronic
971767732 4:30854788-30854810 AAGTGGAAGAGGAGGGTTGTGGG + Intronic
972933607 4:44104624-44104646 CAGTGGAAGGAGAGTGTGGGTGG + Intergenic
973139975 4:46754527-46754549 CACAGGAAGGGGTGGGGGGTGGG + Intronic
973393605 4:49576262-49576284 GAGTGAAAGGTGAGGGTGGGGGG + Intergenic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
975197418 4:71541746-71541768 GAGTGGAAAGGGAAGGTGGGTGG + Intronic
975336072 4:73176556-73176578 CAGAGGCTGGGGAGGGTAGTTGG + Intronic
975568995 4:75792829-75792851 CAGAGGCAGGGCAGGGTAGTGGG - Intronic
975614910 4:76236666-76236688 AAGTGGTGGGGTAGGGTGGTGGG + Intronic
976130225 4:81876326-81876348 GAGGGGAAGGGGAGGGGAGTGGG - Intronic
976161961 4:82211136-82211158 GGGTGGAAGGGGAAGGTGCTGGG + Intergenic
977132006 4:93251662-93251684 GCCTGGAAGTGGAGGGTGGTGGG - Intronic
977623586 4:99164941-99164963 CAGTGGCTGGGAAGGGTAGTGGG - Intergenic
978742686 4:112155035-112155057 TTGTGGCGGGGGAGGGTGGTGGG - Intronic
979942552 4:126779903-126779925 CAGTGGAGGGTCAGGGTGGCAGG - Intergenic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981680792 4:147395416-147395438 CAGGGGAAAGGGTGGGAGGTGGG + Intergenic
981716340 4:147756296-147756318 TAGAGGAAGGTGTGGGTGGTGGG + Intronic
982421898 4:155208469-155208491 TCGTGGAAGGGAAGGGAGGTAGG + Intergenic
982430499 4:155316394-155316416 CAGTGGAAAGACAGGGTGGAAGG + Intergenic
983567385 4:169167891-169167913 CACTGGAAGGCCAAGGTGGTAGG + Intronic
984140795 4:176002053-176002075 CAGTGGGTCGGGAGGGTGGGGGG - Intronic
984237032 4:177171991-177172013 TACTAGAAGGGGAGGGTGGGTGG + Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
1202766184 4_GL000008v2_random:150477-150499 CAGTGGGAGGTGGGGGTGGGAGG - Intergenic
985491974 5:185636-185658 CTGTGGAAGAGGAGGCTGCTGGG + Exonic
985521367 5:375390-375412 CAGTGGGGAGTGAGGGTGGTGGG + Intronic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986065375 5:4229585-4229607 CAGAGGAAGGGCAGGGTTGGCGG - Intergenic
986401722 5:7388710-7388732 CAAGGGAAGTGGAGGGTTGTGGG + Intergenic
988707850 5:33743166-33743188 AAAAGGAAGGGGAGAGTGGTGGG + Intronic
989496681 5:42117077-42117099 CAGTGGAAGGGCACGTGGGTTGG - Intergenic
990045168 5:51420293-51420315 CATTTGGAGGGTAGGGTGGTGGG + Intergenic
990119004 5:52425774-52425796 ACGTGGAGGGGGTGGGTGGTAGG - Intergenic
990318802 5:54609812-54609834 CATTGGAGGTGGAGCGTGGTGGG + Intergenic
990443749 5:55872758-55872780 CATTGGCAGGGTGGGGTGGTGGG - Intronic
990612424 5:57471345-57471367 CAGCGGCTGGGAAGGGTGGTAGG + Intergenic
990743715 5:58937261-58937283 CAGGGGAAGGGGAGGGGCGGGGG + Intergenic
992248584 5:74854605-74854627 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
992453191 5:76891766-76891788 CAGGGGAAGAGGAGAGAGGTGGG + Intronic
992461691 5:76966464-76966486 TGGTGGAAGGGGAGGGTTGTAGG + Intronic
992878567 5:81082342-81082364 GAGAGGAAGGGCAGGGTGGTGGG - Intronic
993768169 5:91889208-91889230 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
994817624 5:104604429-104604451 CAGAGGCAGGGAAGGGTAGTAGG + Intergenic
995755827 5:115502996-115503018 CAGTGTAAGGGGATGTAGGTAGG - Intergenic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996480786 5:123973099-123973121 CATTGGAAGAGGAGCCTGGTGGG - Intergenic
997266188 5:132496646-132496668 GAGCGGAAGGGGAAGGTGGGGGG - Intergenic
997410063 5:133684264-133684286 CAGAGGAAGGTGAGGGTGCAGGG - Intergenic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997737508 5:136224823-136224845 CAGAGGAAGAGAAGGGTGGCAGG - Intronic
997745387 5:136295544-136295566 CAGTGGACGGGGAGGGGACTGGG - Intronic
997820501 5:137061741-137061763 GAGTGGAGGGGGCGGGTGGGAGG + Intronic
998885235 5:146687049-146687071 CAGTGGTAGCGGGGAGTGGTGGG + Intronic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
998921990 5:147079679-147079701 CAGAGGCCTGGGAGGGTGGTAGG + Intronic
998981865 5:147712739-147712761 GAGTGGAAGGGGTGGGTGCTGGG - Intronic
999301056 5:150490642-150490664 CAGTGGAAGAGGTGGATGTTTGG + Intronic
999441691 5:151606186-151606208 AACTTGAAGGGGAGAGTGGTGGG + Intergenic
1000105692 5:158056876-158056898 CATTTGAAGGGGAGGGTTATGGG - Intergenic
1000115366 5:158148917-158148939 GAGGGGAAGGGGAGGGAGGGAGG - Intergenic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1001027307 5:168235010-168235032 CAGTGACAGAGGAGGGAGGTGGG + Intronic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001493148 5:172169496-172169518 CAGAAGAATGGGAGGGTGGGTGG + Intronic
1001838486 5:174852927-174852949 CAGTGGAGGGGGATGGCAGTGGG + Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002916778 6:1535554-1535576 CATTGGAACTGGAGGGTGTTTGG - Intergenic
1003324872 6:5084394-5084416 CGGTGGGCGGGGAGGGTGCTTGG + Intergenic
1003760226 6:9171889-9171911 TAGAGAAAGGGGTGGGTGGTGGG - Intergenic
1003945537 6:11072103-11072125 CAGAGAAAGGGAAGGGAGGTGGG + Intergenic
1004002088 6:11604907-11604929 GAGGGGAAGGGGAGGAGGGTGGG + Intergenic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004617381 6:17303499-17303521 CAGAGGAAGGGGGGGGAGGGGGG + Intergenic
1005068861 6:21845736-21845758 CAGGGGAAGGTGAGGGATGTGGG + Intergenic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005843382 6:29759183-29759205 CATAGCAAGGGGAGGATGGTGGG + Intergenic
1006151628 6:31993022-31993044 CAGGGGAAGGGGAGGAGGGGAGG + Intronic
1006157929 6:32025760-32025782 CAGGGGAAGGGGAGGAGGGGAGG + Intronic
1006333952 6:33410956-33410978 CGGTTGGGGGGGAGGGTGGTGGG - Exonic
1006408831 6:33860280-33860302 CAGCGGAAGGGGTGTGTGGTGGG + Intergenic
1006648861 6:35534778-35534800 CAGTGGCAGGGGAGGGAGGGAGG - Intergenic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007719397 6:43876301-43876323 CAGGCGCTGGGGAGGGTGGTGGG + Intergenic
1007780989 6:44254646-44254668 CAGCAGAAGGGGATGGTGGGAGG + Exonic
1008401445 6:51068273-51068295 AAGTGGCATGGGTGGGTGGTAGG + Intergenic
1008483087 6:52006837-52006859 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1009811214 6:68669391-68669413 CAGAGGCAGGGAAGGGTAGTGGG - Intronic
1010754909 6:79655944-79655966 GAGTGGGAGGGGAAGGTAGTTGG + Intronic
1010992248 6:82492700-82492722 TATGGGAAGTGGAGGGTGGTTGG - Intergenic
1011289590 6:85762858-85762880 CAGGGGAAAGGGTGGGAGGTTGG - Intergenic
1011524522 6:88249184-88249206 GAGTGGAGGGGCAGTGTGGTAGG - Intergenic
1012448283 6:99328636-99328658 CAGATGAAGGGGCTGGTGGTCGG - Intronic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013173709 6:107659887-107659909 CAGGGGAAGGGGAGGCGGGAGGG + Exonic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013820325 6:114146653-114146675 CAGTGGAAGTGGGGACTGGTGGG + Intronic
1013984798 6:116177855-116177877 TACTGGAAGGGCAGGGAGGTTGG + Intronic
1014726744 6:124980368-124980390 TCTGGGAAGGGGAGGGTGGTAGG - Intronic
1014903840 6:127002624-127002646 CAGAGTGAGAGGAGGGTGGTTGG - Intergenic
1016075327 6:139788727-139788749 CAGTGGGAGGGGGTGGTGGGGGG + Intergenic
1016460357 6:144275026-144275048 CCCTGAAAGTGGAGGGTGGTGGG - Intergenic
1016548411 6:145249482-145249504 CAGTGGAGGATGAGGGTGGTAGG - Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017694900 6:157004728-157004750 CGGTGTTAGGGGAGGGTGTTGGG + Intronic
1017742516 6:157419455-157419477 CAGAGGATGGGGAGGGTGTATGG - Intronic
1018315564 6:162553364-162553386 AAGAGGCAGGGGAGGGTGGGAGG + Intronic
1019479794 7:1261247-1261269 CAGGGGCAGGGGAGGATGGCAGG + Intergenic
1019498641 7:1353126-1353148 CAGTGGGTGGGGAAGGCGGTGGG - Intergenic
1019524799 7:1476113-1476135 CAGTGACAGGGGTGGGTGGACGG + Intronic
1019835483 7:3378918-3378940 CCGGGGAAGGGGTGGGAGGTCGG - Intronic
1020419585 7:7986374-7986396 CAGGGGGAGGGGGGGGTGGCAGG + Intronic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG + Intergenic
1022038563 7:26557563-26557585 CAGTGGAAGTGGTGGGGGGTGGG + Intergenic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022970697 7:35514212-35514234 CAGTGGAAGGGGTGGGGAGAGGG - Intergenic
1023820232 7:43976803-43976825 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023923118 7:44645379-44645401 CAGGGGAAGGGGACTCTGGTAGG - Exonic
1023984397 7:45086479-45086501 CGGTGGGAGGGGCTGGTGGTGGG + Intronic
1024368575 7:48552967-48552989 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1025060382 7:55800675-55800697 CAGAGGCTGGGAAGGGTGGTAGG + Intronic
1027150329 7:75728920-75728942 CAGTGAAGGGGGAGTATGGTGGG + Intronic
1027402435 7:77822588-77822610 CAGTGGCAGTGGGGGCTGGTAGG + Intronic
1027443893 7:78249691-78249713 CAGTGGCTGGGGAGGGTAGTGGG + Intronic
1027655894 7:80930436-80930458 GAGTGTGGGGGGAGGGTGGTGGG - Intergenic
1028225283 7:88243880-88243902 AAGTAGAAGGGGATGGTGGTTGG + Intergenic
1029111927 7:98217101-98217123 GAGGGGAAGGGAAGGGTGGGAGG + Exonic
1029118467 7:98250847-98250869 CAGTGAAAGGGAGGGGTGGGGGG + Intronic
1029748520 7:102530324-102530346 CAGGAGAAGGGGTGGGAGGTGGG + Intergenic
1029766467 7:102629408-102629430 CAGGAGAAGGGGTGGGAGGTGGG + Intronic
1029953607 7:104613691-104613713 CCATGGAAGGGCAGGTTGGTTGG - Intronic
1030107812 7:106001300-106001322 CAGTGGAAAGGAGGGGTGGCTGG - Intronic
1030182145 7:106721309-106721331 CATGGGAAGGGGTGGGAGGTTGG - Intergenic
1030626219 7:111848833-111848855 TGGTGGAAGGGGAGGGTTGTAGG - Intronic
1030629660 7:111881920-111881942 CAGTGGCTGGGAAGGGTAGTGGG + Intronic
1030880543 7:114873067-114873089 CAGTGGAAAGGGAAGGCAGTTGG - Intergenic
1031311692 7:120207128-120207150 CAGTGGTCGGGGAGGGTGGCAGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032093791 7:128927359-128927381 CAGTGGAGGGTGGTGGTGGTGGG + Intergenic
1032116406 7:129121449-129121471 GATTGGCAGGGTAGGGTGGTAGG - Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032789503 7:135232112-135232134 CAGTGGTTGGGGCGGGAGGTGGG + Intronic
1033082132 7:138308458-138308480 TAGGGGAGGGGGAGTGTGGTGGG + Intergenic
1033213753 7:139479642-139479664 CAGGGGGAGGGTAGCGTGGTAGG + Exonic
1034160245 7:148988689-148988711 CAGAGGCAGGGAAGGGGGGTTGG + Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035375168 7:158402794-158402816 CGGTGGAGGGACAGGGTGGTGGG + Intronic
1035382624 7:158449310-158449332 CAAGGGCAGGTGAGGGTGGTCGG + Intronic
1036024666 8:4892057-4892079 CAGTAGAAGGTGCGGGAGGTAGG + Intronic
1036616083 8:10388855-10388877 CAGTGGCAGGGGTGGGTCGCAGG - Intronic
1037588522 8:20294650-20294672 CAGTGCAAGGGGAGGAGGGAGGG - Intronic
1037887832 8:22604460-22604482 CAGAGGGAGGCGAGCGTGGTAGG + Intergenic
1038150959 8:24942146-24942168 AAGGAGAAGGGGAGGGAGGTGGG - Intergenic
1038914390 8:32004245-32004267 CAGTGGATGGGGAGGGAAATGGG + Intronic
1039516994 8:38142471-38142493 CATTGGGATGGGAGGGGGGTAGG - Intronic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1039964549 8:42274464-42274486 CAGAGGCAGGAAAGGGTGGTGGG - Intronic
1040764298 8:50888494-50888516 CTGTTGCAGGGTAGGGTGGTGGG - Intergenic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041726835 8:61026018-61026040 CAGGGGGAGGGAAGGGGGGTGGG - Intergenic
1042019631 8:64357667-64357689 AACTGGAAGGGGTAGGTGGTAGG + Intergenic
1043235820 8:77864705-77864727 CAGAGGCTGGGAAGGGTGGTGGG + Intergenic
1043379528 8:79687704-79687726 AGGTGGAGGTGGAGGGTGGTTGG + Intergenic
1043945421 8:86245956-86245978 CAGAGGCTGGGAAGGGTGGTGGG - Intronic
1044091142 8:88003284-88003306 CAGGGGAAGGGGTGGGAGATGGG - Intergenic
1044472777 8:92590032-92590054 CAGAGGGAGGGGAGGGTGTATGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1045864142 8:106845613-106845635 TAGTGGATGGGGTGGGTGATGGG - Intergenic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046116502 8:109791005-109791027 CAGAGGCTGGGGAGGGTAGTAGG + Intergenic
1046137803 8:110052533-110052555 CACTGGAAGGGGAGAGTGTAAGG + Intergenic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047526365 8:125637756-125637778 CAGCTGAAGGAGGGGGTGGTGGG + Intergenic
1048252161 8:132875794-132875816 CATGGGAAGGGTTGGGTGGTTGG + Intronic
1048502748 8:134993704-134993726 CAGTGGAGGGCAGGGGTGGTTGG + Intergenic
1049053924 8:140220173-140220195 CAGCGCCAGGGGAGGGTGGTGGG + Intronic
1049153822 8:141055137-141055159 TGGTGGAAGGGGAGTGTGGAAGG - Intergenic
1049277042 8:141725160-141725182 CACAGGAAGGGGTGGGTGGCGGG - Intergenic
1049301404 8:141872536-141872558 CAGGGTCAGGTGAGGGTGGTGGG + Intergenic
1049301441 8:141872706-141872728 CAGAGGCAGGTGAGGGTGGTGGG + Intergenic
1049301455 8:141872759-141872781 CAGGGGCAGGTGAGGGTAGTGGG + Intergenic
1049301508 8:141872931-141872953 CAGGGGCAGGGGAGGGTGGTGGG + Intergenic
1049575281 8:143386972-143386994 TGGTGGAAGGGGACGGTGGTTGG - Intergenic
1049761668 8:144334474-144334496 GAGGGGGAGGGGAGGGTGGGTGG - Intronic
1050717048 9:8541610-8541632 CACTGGAAGGCCAGGGTGGAAGG - Intronic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1053564620 9:39235963-39235985 CAGTGGCAGGGAAGGGGCGTGGG + Intronic
1053662823 9:40296224-40296246 CAGTGGGAGGTGGGGGTGGGAGG + Intronic
1053830403 9:42073865-42073887 CAGTGGCAGGGAAGGGGCGTGGG + Intronic
1053913270 9:42926399-42926421 CAGTGGGAGGTGGGGGTGGGAGG + Intergenic
1054132532 9:61383071-61383093 CAGTGGCAGGGAAGGGGCGTGGG - Intergenic
1054600155 9:67113590-67113612 CAGTGGCAGGGAAGGGGCGTGGG - Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1056210944 9:84364668-84364690 CAGAGGCTGGGGAGGGTAGTGGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056840796 9:89996662-89996684 GAGTGGGATGGGAGGGTGGAGGG + Intergenic
1056995999 9:91460093-91460115 CAGTGGATGGTGGGGGTGGCTGG - Intergenic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1057489894 9:95512380-95512402 CAGGGGAAGCGGCGGGTGGGGGG - Intronic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057901791 9:98954906-98954928 GAGTGGAGAGGGAGGGTGGGAGG - Intronic
1057987304 9:99730182-99730204 CAGAGGAAGGGGAGAGTGAAAGG - Intergenic
1058646390 9:107135132-107135154 CACTAGATGGGGAGGGAGGTAGG - Intergenic
1058888163 9:109338734-109338756 CAGGGGGAGGGAAGGTTGGTTGG - Intergenic
1058915996 9:109566211-109566233 GAGTGGAAGTGGTGGGTGATAGG + Intergenic
1059132321 9:111766057-111766079 CAGAGGCAGGGAAGGGTAGTAGG - Intronic
1060047715 9:120353849-120353871 CAGTGGCTGGGAAGGGTGGGAGG + Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060898586 9:127237504-127237526 CAGTGGAAGGGGACTGAAGTGGG + Intronic
1060975848 9:127764567-127764589 CAGGTGAGGGGGAGTGTGGTGGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1061393701 9:130331936-130331958 AAGGGGCAGAGGAGGGTGGTGGG - Intronic
1061792658 9:133066713-133066735 AACGGGAAGGGGAGGGTGGGAGG + Intronic
1061796363 9:133087875-133087897 CAGAGGATGGGGAGGGTGCTGGG + Intergenic
1061854912 9:133436791-133436813 CAGAGGAGGGGGATGGCGGTGGG - Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062172328 9:135141952-135141974 CAGGGGATGGGGAGGGAGCTAGG - Intergenic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062530453 9:136997261-136997283 CAGTGGGAGGGATGGGAGGTGGG - Intergenic
1062570940 9:137185068-137185090 CAGTGGATCGAGCGGGTGGTCGG - Exonic
1062576603 9:137211792-137211814 CACGGGAAGGGGAGGTGGGTGGG + Intronic
1062641916 9:137523145-137523167 CAGTGGCAGGTGGGAGTGGTTGG - Intronic
1203546932 Un_KI270743v1:135366-135388 CAGTGGGAGGTGGGGGTGGGAGG - Intergenic
1185630846 X:1514854-1514876 CAGGGGAAGGGGAGGGGGAGGGG - Intronic
1187359558 X:18612333-18612355 CGGTGGCAGGGAATGGTGGTAGG + Intronic
1187972623 X:24674054-24674076 AAGTGGAAGGGGAAGCCGGTTGG - Intergenic
1187975956 X:24705691-24705713 CAGGGGCAGGGGAGGGGGGGAGG - Intronic
1189001105 X:36947960-36947982 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1189261033 X:39678997-39679019 CAGTGTATGGGGCGGGTGGGGGG - Intergenic
1190753289 X:53380527-53380549 CAGTGGAGGGGAAAGGAGGTGGG - Intronic
1191058882 X:56273481-56273503 CAGAGGCAGGGAAGGATGGTGGG - Intronic
1191758785 X:64624591-64624613 CACAGGAAGGGGAGGTTGGGAGG - Intergenic
1192151324 X:68714510-68714532 TAGTGTAAAGGGAGGCTGGTAGG - Intronic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192872449 X:75197077-75197099 CAGTGAGTGGGGAGGGAGGTGGG - Intergenic
1193995424 X:88361043-88361065 CACTGGAGGGGCAGGGTGGTGGG + Intergenic
1194464698 X:94219144-94219166 CAGTGAAAGGTGAGGGGGATAGG - Intergenic
1194602191 X:95935807-95935829 CAGGGGAAAGGGTGGGAGGTGGG - Intergenic
1194770236 X:97894331-97894353 CAGAGGATGGGAAGGGTAGTGGG - Intergenic
1196205951 X:112939664-112939686 CAGAGGTTGGGGAGGGTAGTAGG + Intergenic
1196287594 X:113900258-113900280 CAGTGAATGGGGATGGGGGTGGG - Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196679249 X:118454000-118454022 CAATGGGAGTGGAAGGTGGTGGG + Intergenic
1196884346 X:120228751-120228773 CAGGGGAGGGGGTGGGTTGTAGG - Intergenic
1197554373 X:127936488-127936510 GAGTTGAATGGGAGTGTGGTGGG + Intergenic
1197862393 X:130984676-130984698 CAGGGGAAGGGAAGGCTGGCAGG + Intergenic
1197980590 X:132215083-132215105 CAGTGCAAGGGGAGTCTGGGTGG + Intronic
1198436441 X:136621358-136621380 CAGAGGCTGGGAAGGGTGGTGGG - Intergenic
1199271450 X:145888130-145888152 CAGTAGCAGGGGAGGGTGTTGGG - Intergenic
1199708160 X:150449118-150449140 CAGTGGTTGGGCAGGGTGGGGGG + Intronic
1199737892 X:150702020-150702042 CAGTGGATGGGAATGGGGGTGGG - Intronic
1200092094 X:153640753-153640775 CAGTGGAGGGGGAGTGTGAAAGG + Intergenic
1200259837 X:154608251-154608273 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200266791 X:154650489-154650511 CTGAGGAAGGCGAGGGGGGTTGG - Intergenic
1200480749 Y:3700385-3700407 CATGGGGTGGGGAGGGTGGTGGG - Intergenic
1201355980 Y:13097421-13097443 CAGTGGAAGGAGATAGGGGTGGG - Intergenic
1202627119 Y:56871089-56871111 CCGTGGAAGGGGAGGAGGGGTGG - Intergenic