ID: 946026048

View in Genome Browser
Species Human (GRCh38)
Location 2:216672621-216672643
Sequence GGGCTACGGTGTGACAGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946026048 Original CRISPR GGGCTACGGTGTGACAGTGG CGG Exonic
900169517 1:1259770-1259792 GGGCCACGCTGTGACTGTGGGGG - Intronic
904776611 1:32912353-32912375 GGGCTACGATATGAGAGAGGTGG - Intergenic
906212705 1:44021053-44021075 GGGAAATGGTGTGACATTGGTGG + Intronic
906227655 1:44134786-44134808 TGGCTAGGGTGTGAGAGTGGAGG + Exonic
907149376 1:52269079-52269101 TGGCTACGATGTGTCAGTGTAGG - Intronic
907518135 1:55006254-55006276 GGGCTCCTGTGATACAGTGGGGG + Intronic
908538875 1:65103872-65103894 GGGCTAAGGTGGGAGAGGGGAGG - Intergenic
912947654 1:114098013-114098035 GGGCTTCTGGGTGTCAGTGGCGG + Intronic
1065044424 10:21733878-21733900 GGTCAATGGCGTGACAGTGGGGG + Exonic
1065478141 10:26163409-26163431 GGGCAGGGGAGTGACAGTGGAGG + Intronic
1071918847 10:90326884-90326906 CTGCTACGCTGTGCCAGTGGAGG + Intergenic
1074024435 10:109619727-109619749 GGGATGGGGTGGGACAGTGGAGG + Intergenic
1077460355 11:2706077-2706099 GGGGTACCGTGTGGCTGTGGTGG + Intronic
1078334863 11:10455472-10455494 GGGCTCCGGTGGGTCAGTTGGGG + Intronic
1085219092 11:74858272-74858294 CGGCAAGGGTGTAACAGTGGGGG + Intronic
1085446145 11:76602547-76602569 GGGCTGCGCTGTGTCAGTGCAGG - Intergenic
1087307130 11:96500924-96500946 GTGCTCCGGGGTGACGGTGGAGG - Intronic
1089540617 11:119187368-119187390 GGCCTAGGGTGGGACAGAGGTGG - Exonic
1090351260 11:126110040-126110062 GGGCTGTGGTGTGAGAGAGGAGG - Intergenic
1092843210 12:12562453-12562475 GGGCCGCGTTGTGAAAGTGGGGG + Intergenic
1095959510 12:47825443-47825465 TGGCTAAGATGTGAAAGTGGGGG + Intronic
1096101481 12:48972712-48972734 GGGCTGCGGTCTGGCAGGGGCGG - Intergenic
1096503116 12:52077388-52077410 GGGCTATGGAGAGACAGTAGAGG - Exonic
1097645498 12:62232252-62232274 TGGCCAGGGTGTGAGAGTGGAGG - Intronic
1103941007 12:124501194-124501216 GGGCCAGGCTGGGACAGTGGAGG - Intronic
1106906361 13:34413641-34413663 GGGCTAAGGATGGACAGTGGTGG + Intergenic
1112180199 13:97070598-97070620 GGTCTAGGGTGTGACTGTCGGGG - Intergenic
1122482173 14:102054356-102054378 GGCCTTCGGTGTGAAGGTGGAGG - Intergenic
1125181174 15:36882329-36882351 GGGCTATTGTGTGACAATTGAGG - Intergenic
1128757825 15:70195462-70195484 GAGCTACGGTGAGACTGTGCAGG - Intergenic
1130046571 15:80450431-80450453 GGGCAACGGAGGGGCAGTGGCGG + Intronic
1130069676 15:80635870-80635892 TGGATATGGTGTGGCAGTGGTGG + Intergenic
1130997846 15:88913551-88913573 GGACGCCGGTGTGGCAGTGGCGG - Intergenic
1133042559 16:3068194-3068216 GGGCTACCTGGAGACAGTGGCGG + Exonic
1134175738 16:12004628-12004650 GGGCTAGGGTGAGAGGGTGGGGG - Intronic
1134704407 16:16292291-16292313 GGGCTAGAGAGTGACTGTGGGGG - Intronic
1134963135 16:18419823-18419845 GGGCTAGAGAGTGACTGTGGGGG + Intronic
1134967430 16:18502422-18502444 GGGCTAGAGAGTGACTGTGGGGG + Intronic
1135864697 16:26090602-26090624 GGGCTGCTGTGTGGCAGTGGAGG - Intronic
1139554166 16:67695929-67695951 GGAACACGGTGTGAGAGTGGAGG - Intronic
1142074259 16:88108302-88108324 GGGCCACAGTGTGACGGTGCAGG - Intronic
1143776207 17:9200556-9200578 GGGCTACAGGCTGAAAGTGGGGG + Intronic
1144766983 17:17738312-17738334 GGGCTATGGTGTGAGTGGGGCGG + Intronic
1146582115 17:34047774-34047796 GGGCTGCAGTCTCACAGTGGAGG - Intronic
1147994413 17:44353297-44353319 GGGCTACGATGTCACAGGGCTGG - Exonic
1148748663 17:49932194-49932216 GGGCCAGGGTGTCACAGGGGAGG - Intergenic
1149964178 17:61145422-61145444 GGGCTACGGAGAGGGAGTGGGGG + Intronic
1151354064 17:73548221-73548243 GGGCTAGGAAGTGGCAGTGGTGG + Intronic
1151783300 17:76261935-76261957 GGGCTGCTGAGGGACAGTGGAGG - Intergenic
1152088150 17:78232457-78232479 GGGCTGTGGGGCGACAGTGGGGG + Intronic
1152577529 17:81149415-81149437 GGGCTGGGGTGTGAGGGTGGGGG - Intronic
1155192044 18:23438789-23438811 GGACTGCGATGAGACAGTGGTGG - Intergenic
1160210493 18:76874173-76874195 GGGCAAGGGTGTGAAAGAGGAGG - Intronic
1160532315 18:79572599-79572621 GGGCTCCTGGGTGACAGTGCAGG + Intergenic
1163091193 19:15021543-15021565 GGGCCAGGGTGGGACAGGGGAGG + Intronic
1163369165 19:16892478-16892500 GGGATAAGGTGGGACAATGGGGG + Exonic
1163505213 19:17701722-17701744 AGGCTACTGTGTGATAGTGGAGG + Intergenic
1164756241 19:30691884-30691906 GGGCCACGCTGTGGCAGTGGTGG + Intronic
1166916598 19:46199583-46199605 GGCCTGGGGTGAGACAGTGGAGG - Intergenic
1167058758 19:47130422-47130444 GGGCTACAGAGTAACAGGGGTGG - Intronic
1168288451 19:55345874-55345896 GGGCTTGGGTGTGGCAGAGGAGG + Intronic
932309490 2:70728305-70728327 GGGCTCCAGTGTGACAGAGTCGG + Intronic
934526518 2:95055604-95055626 GGGCTGGGGTGTGAGGGTGGGGG - Intergenic
934621381 2:95810601-95810623 GGGCTACTGTGGGCCTGTGGGGG + Intergenic
934812061 2:97288213-97288235 GGGCTACTGTGGGCCTGTGGGGG - Intergenic
934825632 2:97419714-97419736 GGGCTACTGTGGGCCTGTGGGGG + Intergenic
936285331 2:111177056-111177078 GGGCAAGGGTGTGCCTGTGGAGG - Intergenic
939996641 2:148926341-148926363 GGGCTATGCTGTACCAGTGGAGG + Intronic
945833774 2:214814265-214814287 GGACTACAGTGTTACAGTGGGGG - Intergenic
946026048 2:216672621-216672643 GGGCTACGGTGTGACAGTGGCGG + Exonic
949034306 2:241809613-241809635 GGGCCATGGGGTGACAGTTGGGG + Intronic
1170794153 20:19532040-19532062 GGGCTCCAGTGTTCCAGTGGTGG + Intronic
1171229054 20:23467577-23467599 GGGTAACGGTGGGACAGTGTGGG + Intergenic
1172194564 20:33083234-33083256 GGGCTGCTGGGTGGCAGTGGTGG + Intronic
1172194581 20:33083282-33083304 GGGCTGCTGGGTGGCAGTGGTGG + Intronic
1173613796 20:44389781-44389803 GGGCTATGGGGGGACAGAGGAGG + Intronic
1173747424 20:45448603-45448625 GGGCTACGGTGAGAGAGTCCTGG - Intergenic
1174163653 20:48569558-48569580 GGGCAAAGATGTGAGAGTGGAGG - Intergenic
1175538273 20:59730412-59730434 GGGCTCTGGGGTTACAGTGGGGG + Intronic
1175853585 20:62107006-62107028 GGGTTAGGGTGGGAGAGTGGGGG - Intergenic
1178531933 21:33383071-33383093 GGGCTCCCGTGTGCCAGGGGAGG - Intergenic
1178859355 21:36276030-36276052 GGTCAAGGGTATGACAGTGGTGG + Intronic
1185317696 22:50186050-50186072 GGGCCGCGGGGTGACTGTGGGGG + Intronic
950139292 3:10604207-10604229 TGGCTACGGGGTGAGAGGGGAGG - Intronic
951460807 3:22949686-22949708 GGGCTACAGTGGGACAGGGAGGG - Intergenic
951708981 3:25570622-25570644 GGTCTAGGTTGTGCCAGTGGAGG + Intronic
952423699 3:33153494-33153516 TGGCTACCCTGTGACAGAGGGGG - Exonic
953472474 3:43178929-43178951 GGTGTACGGGGTGACGGTGGTGG - Intergenic
955468377 3:59259801-59259823 GGGCTAAAGTGTGACACTGCGGG - Intergenic
959846100 3:111035688-111035710 GGGCTACAGTGCCACAGTGCTGG + Intergenic
961420158 3:126796842-126796864 GGACTACGGAGATACAGTGGAGG - Intronic
961576951 3:127844998-127845020 GGGCTACTGCCTGACAGTGCTGG + Intergenic
963775873 3:149438969-149438991 GGGCTACACAGAGACAGTGGTGG - Intergenic
968232384 3:197011484-197011506 GGATGACAGTGTGACAGTGGGGG + Intronic
969139434 4:5055700-5055722 GGGCTATGGTGTGAGGGTGCAGG - Intronic
970268947 4:14322056-14322078 GGGCTATGGTCTGACTGAGGAGG - Intergenic
973053953 4:45630788-45630810 TAGCTACTGTGAGACAGTGGGGG - Intergenic
975281491 4:72568129-72568151 GGGCTAGGATTTGACAGTTGGGG - Intronic
983495211 4:168435688-168435710 GGGCTAGGGTAGGACAGTGAAGG - Intronic
988418027 5:30970706-30970728 GGGCTACTCTGTCACAATGGAGG - Intergenic
995705820 5:114988778-114988800 GGGCTACTCTTTCACAGTGGGGG - Intergenic
997234649 5:132265774-132265796 GGGCTACTGAGTGACAGGGCTGG + Intronic
997297250 5:132776236-132776258 AGGCTAGGCTGTGACAGTGAAGG - Intronic
999948242 5:156620676-156620698 GGACTATGGTGTGACAGAGGAGG + Intronic
1004074035 6:12329108-12329130 GGGGTAGGGAGTGAGAGTGGAGG - Intergenic
1013217990 6:108047636-108047658 GGGCTAGGGTTTACCAGTGGAGG + Intronic
1013544313 6:111140599-111140621 AGGCTAAGGTATGCCAGTGGAGG + Intronic
1013880303 6:114891188-114891210 TGACTACTGTGTCACAGTGGAGG - Intergenic
1020211115 7:6158838-6158860 GGGCTACTGGGAGACAGTGATGG + Intronic
1023966107 7:44963803-44963825 TGGCTAGAGTGTGAGAGTGGGGG + Intronic
1029730412 7:102434524-102434546 GGGCTCAGGTCTGAGAGTGGAGG - Intronic
1030158778 7:106485625-106485647 GGGAAAGGGTGTGACATTGGAGG + Intergenic
1030159416 7:106492011-106492033 GGGAAAGGGTGTGACATTGGAGG + Intergenic
1032704375 7:134409405-134409427 TGACTATGGTGTGTCAGTGGTGG - Intergenic
1034461332 7:151199580-151199602 GGGCTGCTGTGTGGGAGTGGAGG - Intronic
1034994474 7:155569585-155569607 GGGCTGAGGTGTGAGAGTGGAGG - Intergenic
1042752268 8:72170782-72170804 GGGCTGTTGTGTGTCAGTGGAGG + Intergenic
1044884527 8:96762567-96762589 GGGCTACAGAGGGACAGTGATGG + Intronic
1045184065 8:99818068-99818090 GGGGTAGGGTGGGACTGTGGGGG + Intronic
1057138630 9:92713407-92713429 GGGCTGCAGTGTGACAGGGCCGG + Exonic
1059868581 9:118545506-118545528 GAGCTAGTGTGTGCCAGTGGGGG - Intergenic
1060688699 9:125636869-125636891 GGGCTAAGGTGTGAGTGTGGTGG - Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1061613242 9:131762550-131762572 GGGCTAGGATGGAACAGTGGCGG + Intergenic
1188833746 X:34932017-34932039 GGGCTGGTGTGTGTCAGTGGGGG - Intergenic
1193423111 X:81308289-81308311 GGGCTCCAGTGGGGCAGTGGTGG + Intergenic
1194426004 X:93739209-93739231 GTGCTATGGTGGGGCAGTGGTGG + Intergenic
1196216274 X:113055533-113055555 GGGGTAGGGTGTGAGAGTAGAGG + Intergenic