ID: 946027328

View in Genome Browser
Species Human (GRCh38)
Location 2:216679690-216679712
Sequence CTTCATAAGCGGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946027315_946027328 25 Left 946027315 2:216679642-216679664 CCTAGGAGGAGGGGGTCCTGGGG 0: 1
1: 1
2: 7
3: 76
4: 678
Right 946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 177
946027320_946027328 9 Left 946027320 2:216679658-216679680 CCTGGGGTCTGGAGCAGCAGGGT 0: 1
1: 0
2: 2
3: 33
4: 372
Right 946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946027328 Original CRISPR CTTCATAAGCGGCAGGAGGA GGG Intronic
900950853 1:5857674-5857696 TTTCAACAGGGGCAGGAGGAGGG + Intergenic
901452483 1:9344565-9344587 GTTGAGAGGCGGCAGGAGGAGGG + Intronic
902163605 1:14552220-14552242 ATTAATAGGGGGCAGGAGGATGG - Intergenic
903515270 1:23906223-23906245 TTTAATAAGGGGCAGGAGGTGGG - Intronic
904250618 1:29221507-29221529 CTGCATAAGAGCCAGGAGAATGG + Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906896173 1:49774476-49774498 CTTTATATGGGGCAGGTGGAGGG + Intronic
909316338 1:74223981-74224003 CTCTATAATCAGCAGGAGGAGGG - Intronic
910550008 1:88464881-88464903 CTCCATAAGAGGCTGGAGGTGGG - Intergenic
911830850 1:102550062-102550084 CTTCATTAGCAGCATGAGAATGG - Intergenic
912932037 1:113972843-113972865 CTTGCTAAGAGGCAGAAGGAGGG + Intronic
913126142 1:115792190-115792212 CTTCATCAGCAGCTGGAGGCAGG - Intergenic
914952563 1:152129751-152129773 CTTCATGAGCGTCAGTAGAATGG - Intergenic
915103626 1:153518251-153518273 CTTCAAAAGGGCCAGGTGGATGG + Intergenic
920039913 1:203088842-203088864 CCTCTTCAGAGGCAGGAGGATGG + Intergenic
921551921 1:216547331-216547353 CTTCAAAAACTGCATGAGGAAGG - Intronic
922546542 1:226462087-226462109 CTTCATAAGAGGGAGGCAGAGGG + Intergenic
922614166 1:226951348-226951370 CTCCTGAAGCGACAGGAGGAGGG + Intronic
1063121727 10:3109446-3109468 CTCCATCAGCGGCAGGCGCACGG - Exonic
1065922493 10:30404875-30404897 CTTTATAAGCAGCATGAGAATGG + Intergenic
1069802392 10:71090177-71090199 ATTGATAAGCCCCAGGAGGATGG - Intergenic
1071774999 10:88776927-88776949 TTTCATAAGGGACAGGAGAATGG - Intronic
1073107788 10:101042482-101042504 CTTCATAATAGGCAGGATGGGGG - Intergenic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075412303 10:122237563-122237585 ATTTATAAGTGGCAGGAAGAGGG - Intronic
1075637516 10:124039366-124039388 CTTCCAAAGCGTCAGGAGAAAGG + Intronic
1078945823 11:16067588-16067610 CCTCATTAGCAGCATGAGGATGG + Intronic
1079570949 11:21942626-21942648 CTTTATAAGCAGCATGAGAATGG + Intergenic
1081016396 11:37887110-37887132 CTTCATTAGCAGCATGAGAATGG - Intergenic
1081299192 11:41429328-41429350 CTTTATTAGCAGCATGAGGACGG + Intronic
1081444518 11:43117691-43117713 CTTCATTAGCAGCATGAGAATGG - Intergenic
1081646766 11:44795635-44795657 AATCAGAAGCGGCAGGAGTAAGG - Intronic
1082720657 11:56671459-56671481 CTTCATCGGAGGCAGGAGGGAGG + Intergenic
1084114151 11:67032011-67032033 TGTCAACAGCGGCAGGAGGAAGG + Intronic
1089101017 11:115962572-115962594 CTTCATAACCTGCTGGAGTAGGG - Intergenic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1092144132 12:6202924-6202946 CTTCATCAGAGGCAGGAAGATGG + Intronic
1099692801 12:85981609-85981631 CTACATAAGAGGCAGGAGTTTGG + Intronic
1099826278 12:87780988-87781010 CTTTATTAGCGGCATGAGAACGG - Intergenic
1099958086 12:89370696-89370718 CTTCATATCCTGCAGGAGAAAGG + Intergenic
1101201059 12:102436813-102436835 ATACATAAGTGGCAGGAAGAAGG + Intronic
1102397620 12:112600803-112600825 CTTTATTAGCAGCATGAGGACGG - Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1105600904 13:21886050-21886072 GTTCAGAGGCGGCAGGAGGTGGG + Intergenic
1106000183 13:25715047-25715069 CTTCATAAGTGGCATGAGAATGG - Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115190525 14:30743166-30743188 CTTTATTAGCGGCACGAGAATGG + Intergenic
1115662000 14:35505431-35505453 ATTCATAAGCGGCAGGGGCAAGG + Intergenic
1119468282 14:74876681-74876703 CTTCTCAAGCTGAAGGAGGAGGG - Intergenic
1119566895 14:75636472-75636494 CTTGCTCTGCGGCAGGAGGAGGG + Intronic
1119764054 14:77177245-77177267 CTTTATCAGCAGCATGAGGACGG - Intronic
1202946632 14_KI270726v1_random:33545-33567 CTTTATCAGCTGCAGGAGGCGGG + Intergenic
1123674067 15:22690649-22690671 CTTCAGAAGCTTCAGGAGCAAGG + Intergenic
1124326075 15:28763641-28763663 CTTCAGAAGCTTCAGGAGCAAGG + Intergenic
1129166946 15:73784072-73784094 CTTTATTAGCAGCAGGAGAATGG + Intergenic
1132849024 16:2015912-2015934 CTTTTCAGGCGGCAGGAGGAAGG - Intronic
1137745535 16:50817490-50817512 CTGGATTAGCGGCAGGAGGTGGG + Intergenic
1137760666 16:50937581-50937603 CTTCATCAGCAGCAGGAAAACGG + Intergenic
1140760445 16:78104103-78104125 CTTCATAAGAGGCACGGGGAAGG - Intronic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141072774 16:80973236-80973258 CTTAATATGAGGCAGAAGGAAGG - Exonic
1141342857 16:83219056-83219078 CTTCATTAGCAGCATGAGAACGG + Intronic
1141562192 16:84876964-84876986 CTTGATTAGCGGCAGGAGGTAGG + Intronic
1141853932 16:86668094-86668116 CTTCATCAGCCCCAGGAGGTAGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1142493448 17:293246-293268 CTGCATGAGTGGCAGGCGGAGGG - Intronic
1143612691 17:8028765-8028787 CATCATAATAGGCAGGAGGCTGG - Intergenic
1144060427 17:11579216-11579238 ATTCATAGGCCTCAGGAGGAAGG - Intergenic
1154311947 18:13273790-13273812 CTGCATGAGGGGCTGGAGGATGG - Intronic
1156356091 18:36341490-36341512 GTTCATGAGCGGCAGGTGCAGGG + Intronic
1160677468 19:399093-399115 TTTTATACGCAGCAGGAGGAAGG - Intergenic
1165117475 19:33537580-33537602 CTTTATCAGCGGCATGAGAACGG - Intergenic
1166165044 19:40981556-40981578 CTTCATTAGCAGCATGAGAATGG - Intergenic
1166645566 19:44529419-44529441 CTTCAGATGCGGGAGGAGGGAGG - Intronic
1167300331 19:48674084-48674106 GTGCATCAGCTGCAGGAGGATGG + Intergenic
1167825012 19:51964522-51964544 CTTCATAAGGGGCAGTTGGTGGG - Exonic
926415555 2:12646234-12646256 CTTTATAAGCAGCATGAGAATGG - Intergenic
926786281 2:16521489-16521511 CTTCATCTGAGGCTGGAGGAAGG + Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
927573353 2:24179707-24179729 CTTCATTCAGGGCAGGAGGAAGG + Intronic
931355961 2:61537917-61537939 CAGCAGAAGCGGCAGGAGTAGGG + Exonic
931812058 2:65863702-65863724 ATCCATAAGCCACAGGAGGAAGG - Intergenic
933223994 2:79724416-79724438 CTTCATGAACAACAGGAGGATGG + Intronic
933260646 2:80127609-80127631 CTTCTTCAGGGGCAGGAAGAAGG - Intronic
933616636 2:84488627-84488649 CTACATAAGAGGGAGGAGGCAGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
938792842 2:134692039-134692061 CCTCATAAGAGACAGGTGGAGGG + Intronic
941037403 2:160583463-160583485 CTGCATCAAAGGCAGGAGGAGGG - Intergenic
941726356 2:168864904-168864926 CCACATAAGCGGCAGGAAAATGG - Exonic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942487488 2:176454951-176454973 TTTCATAAGAGGTGGGAGGAAGG + Intergenic
942647879 2:178134220-178134242 CTGCAGAAGTGGCAGAAGGAAGG + Intronic
945740185 2:213650320-213650342 TTTCATATGAGGCAGGAGTATGG - Intronic
946027328 2:216679690-216679712 CTTCATAAGCGGCAGGAGGAGGG + Intronic
947922946 2:233894080-233894102 CTTCATCTTCTGCAGGAGGAAGG + Intergenic
948103012 2:235390362-235390384 CTTTATAAGAGGCAGGAGGTCGG - Intergenic
1170231427 20:14050926-14050948 CTTCAGAGGAGACAGGAGGAGGG + Intronic
1171401412 20:24875027-24875049 CTGCTTAAGGGGCAGGAGGTGGG - Intergenic
1173536882 20:43821938-43821960 ATTCATAAGAGGCTGGGGGAAGG - Intergenic
1173653612 20:44683634-44683656 CCTCTCAAGAGGCAGGAGGAAGG - Intergenic
1173924435 20:46770342-46770364 CTTTATTAGCAGCATGAGGATGG - Intergenic
1175155496 20:56968319-56968341 CTTCATAGGGGGCTGGAGGGAGG - Intergenic
1175713030 20:61236268-61236290 CTTGACAAGTGTCAGGAGGATGG - Intergenic
1177008163 21:15699508-15699530 CTTTATTAGCGGCATGAGAATGG - Intergenic
1179150652 21:38805882-38805904 CTTCAGGAGCGGGAGGAGGAGGG - Intronic
1180743119 22:18067540-18067562 CCTCATAAGGATCAGGAGGAGGG - Intergenic
1181971184 22:26691297-26691319 CTTAACAAGAGGCTGGAGGAAGG + Intergenic
1183456189 22:37924609-37924631 CTTCATGGGCAGCAGGAGGTGGG - Intronic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
950472847 3:13197310-13197332 CTTCATAAACGGCAGATGCATGG + Intergenic
952538874 3:34345175-34345197 CTTCATTAGCAGCATGAGAACGG + Intergenic
954445711 3:50545832-50545854 CCTCAAAGGGGGCAGGAGGAGGG - Intergenic
955242368 3:57189637-57189659 CTACAAAAGCGGCAGCATGAGGG - Intergenic
960675883 3:120194386-120194408 CATCATAACCGCCAGGAGCACGG + Intronic
962677507 3:137767914-137767936 CTTCCTAGGGGGCGGGAGGAGGG - Intergenic
963850718 3:150207910-150207932 CTTAAGAAGCGGGGGGAGGAAGG + Intergenic
964431742 3:156614355-156614377 CTTCATAATAGGAAGGAGGCTGG + Intergenic
968945047 4:3659185-3659207 CTCCAAAAGCGGGAGGATGAAGG + Intergenic
970191945 4:13525701-13525723 CTTCATAAGAGGCCAGTGGAAGG - Intergenic
970780702 4:19734343-19734365 CTTCATTAGCAGCATGAGAACGG - Intergenic
973972536 4:56227901-56227923 CTTCCTAAGAGGCAGGGAGAGGG - Intronic
974340273 4:60605470-60605492 CTGCATTAGCGACAGGAGAATGG - Intergenic
975204167 4:71624957-71624979 CTTCATCAGCAGCAGGAAAATGG - Intergenic
975426967 4:74241092-74241114 CTTAATTAGCGCCAAGAGGAAGG + Intronic
977089630 4:92653974-92653996 CTTCATATGTGGAAAGAGGATGG + Intronic
977853942 4:101865033-101865055 CTTGATCAGGGGCAGGAAGAAGG + Intronic
978892079 4:113841856-113841878 CTTCATAAGTGGCAGGGGAGAGG - Intergenic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG + Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
987137890 5:14916879-14916901 CTTTATCAGCAGCAGGAGAATGG + Intergenic
991029389 5:62067009-62067031 CTACATAAGTGACAGGAGAATGG - Intergenic
992790836 5:80212195-80212217 CTTAATAAACGGCAGTGGGATGG + Intronic
993336922 5:86671185-86671207 CTTTATAAGCAGCATGAGAATGG + Intergenic
996164140 5:120204756-120204778 CTTCATTAGCAGCAGGAGAATGG - Intergenic
999230748 5:150060535-150060557 CTTCATAAGAGGTAGGCGGGGGG + Intronic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002103144 5:176867242-176867264 CTACAGACGGGGCAGGAGGAGGG + Intronic
1002170681 5:177372400-177372422 CTTCAACAGGGGCAAGAGGAGGG + Exonic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1004627453 6:17390212-17390234 CATCTTAAGTGGCAGGAGCAAGG - Intergenic
1005844562 6:29767321-29767343 CCCCATAAGCTGCAGGAGGCTGG + Intergenic
1005854517 6:29850591-29850613 CTGCAGCAGCGACAGGAGGAGGG - Intergenic
1006796474 6:36735524-36735546 CTTCAGAGACGGCAGGAGGAGGG - Intergenic
1007689130 6:43687451-43687473 CTTCACAAGGCGGAGGAGGACGG - Intronic
1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG + Intergenic
1010061137 6:71624582-71624604 CTTCATTAGCAGCATGAGAAAGG + Intergenic
1010712913 6:79196100-79196122 CTTTATTAGCAGCAGGAGAATGG - Intergenic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1013408800 6:109866108-109866130 CTTCAGTAGCTGCGGGAGGAAGG + Intergenic
1014439520 6:121458258-121458280 CTACTCAAGAGGCAGGAGGATGG - Intergenic
1014863077 6:126495578-126495600 CTTTATAAGCGGCATGAAAATGG - Intergenic
1016085313 6:139906415-139906437 CTTTATTAGCGGCATGAGAATGG - Intergenic
1016223398 6:141704334-141704356 CTCCTTATGTGGCAGGAGGATGG + Intergenic
1017585674 6:155919851-155919873 CTTCATAAGTGGCAGTGGGAAGG + Intergenic
1018433660 6:163742846-163742868 CTTCCTAAGGGGTTGGAGGATGG + Intergenic
1018953647 6:168394080-168394102 AGACATAAGCGGCAGCAGGAGGG - Intergenic
1019064864 6:169288291-169288313 CTTTATGAGAGGCAGGTGGAAGG - Intergenic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1021341199 7:19464372-19464394 CTTTATTAGCAGCATGAGGACGG + Intergenic
1022652539 7:32290293-32290315 CTACATAAGTGGCTGGTGGAGGG + Intronic
1023661231 7:42473037-42473059 GTCCATGAGCGGCAGCAGGAAGG - Intergenic
1025014514 7:55428073-55428095 CAGCTGAAGCGGCAGGAGGAAGG + Intronic
1026403877 7:70044148-70044170 CCTCTCCAGCGGCAGGAGGAGGG - Intronic
1031778909 7:125938565-125938587 CTTCATTAGCAGCATGAGAATGG + Intergenic
1034371715 7:150603867-150603889 GTTCTTAAGCTGCATGAGGAGGG - Intergenic
1038159293 8:25021473-25021495 CTTCATTAGCAGCATGAGAAAGG + Intergenic
1040546442 8:48401626-48401648 CTGCAAAAGGGGTAGGAGGAAGG + Intergenic
1045646856 8:104307849-104307871 CTTCATTAGCAGCATGAGAATGG - Intergenic
1045959793 8:107953651-107953673 TTTCCTAAGCAGCAGGATGATGG + Intronic
1052689871 9:31803048-31803070 CTTTATTAGCGGCATGAGAATGG + Intergenic
1054832869 9:69645662-69645684 CTTCAGCAGTGGCAGGAGAAGGG + Intronic
1055710853 9:79060526-79060548 CTTCATAAGAGGCAGGCGGGAGG - Intergenic
1055781466 9:79825744-79825766 CTTAATAAGTGGCAAGAGAATGG + Intergenic
1058556434 9:106173608-106173630 CTTCATAACAGACAGGAAGATGG - Intergenic
1062158617 9:135067621-135067643 CTCCAGAAGCTGCAGGAGGCAGG + Intergenic
1187581306 X:20610267-20610289 CTTCCCAAGCAGCAGAAGGAAGG + Intergenic
1188155776 X:26740792-26740814 CTTCATTAGCAGCATGAGGATGG - Intergenic
1190087762 X:47410580-47410602 CTTCATGAGCTGCACAAGGAAGG - Intronic
1192156493 X:68750655-68750677 CTCCATGAGAGGCAGGATGAAGG + Intergenic
1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG + Intergenic
1192863902 X:75108962-75108984 CTTCATAAGCTTCATGAGGCTGG + Intronic
1193849313 X:86516706-86516728 CTTGAGAAGGGGCAGGAAGAGGG - Intronic
1194427917 X:93762838-93762860 CTTCATAAGAGATAGGAAGAGGG - Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1195697720 X:107679096-107679118 CTTCATCAGGGACAGGAGGAGGG - Intergenic
1197840179 X:130737893-130737915 GTTCACAAGGGGCTGGAGGATGG + Intronic
1197995349 X:132366877-132366899 CTTTATTAGCAGCATGAGGATGG - Intergenic
1198612969 X:138422397-138422419 CTTAACAAGCGGCAGGGAGATGG + Intergenic