ID: 946027338

View in Genome Browser
Species Human (GRCh38)
Location 2:216679723-216679745
Sequence CCAGAAATGTAGGCCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946027326_946027338 11 Left 946027326 2:216679689-216679711 CCTTCATAAGCGGCAGGAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 946027338 2:216679723-216679745 CCAGAAATGTAGGCCCGGAGGGG 0: 1
1: 0
2: 0
3: 25
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946027338 Original CRISPR CCAGAAATGTAGGCCCGGAG GGG Intronic
900229261 1:1548046-1548068 CCAGAAAAGTGGGCCAAGAGAGG + Intronic
901040480 1:6360261-6360283 CCCAAAATGTCTGCCCGGAGGGG + Intronic
903331342 1:22598577-22598599 CGAGAGATGGAGGCCCAGAGAGG - Intronic
903596581 1:24500105-24500127 CAAGAAATGGAGGCCGGGTGCGG + Intergenic
904078931 1:27859688-27859710 ACAGAAAAGGAGGCCGGGAGTGG + Intergenic
904275778 1:29383326-29383348 CCTGAAATGTAAGCCCTGAGTGG - Intergenic
904423168 1:30407128-30407150 CCTGAAATGTAAGCCCTGAGTGG + Intergenic
904816990 1:33211221-33211243 CCTTAAATGTAGGCCTGGCGCGG - Intergenic
907044926 1:51294813-51294835 CCAGAAATGGAGCCTGGGAGTGG - Intronic
907078015 1:51595445-51595467 ACAGAAATGCAGGGCCTGAGGGG + Intronic
907195067 1:52679859-52679881 AAAGAAATGTAGGCCAAGAGCGG + Intergenic
907266084 1:53262273-53262295 CTAGAAATGTGGGCAGGGAGAGG - Intronic
909931936 1:81506416-81506438 CAAGAAATGTTGGCCAGGCGCGG + Intronic
911847560 1:102773437-102773459 CAAAAAATGTTGGCCAGGAGTGG - Intergenic
912403628 1:109417931-109417953 AAAGAAATGTGGGCCAGGAGTGG + Intronic
912655183 1:111480213-111480235 ACAGAAATGGAGGCACAGAGAGG + Intergenic
917740274 1:177955203-177955225 AGAGAAATGCAGGCCCGGTGCGG + Intronic
919781255 1:201222651-201222673 CCAGCAAGGTAGGGCTGGAGGGG - Intronic
919924497 1:202185417-202185439 CCAGAAAGGTGGGCAGGGAGGGG + Intergenic
920547542 1:206830865-206830887 AAAGAAACGTAGGCCAGGAGCGG - Intronic
920944208 1:210512806-210512828 CTAGAAATATAGGCCATGAGAGG - Intronic
921009073 1:211123212-211123234 ACAGAAAACTAGGCCTGGAGTGG + Intronic
922328863 1:224556336-224556358 CCAGAAATGGAGGCTTAGAGAGG - Intronic
922488630 1:225997719-225997741 CAAGAAATATAGGCCAGGCGTGG - Intronic
923552603 1:234976073-234976095 GCAGAAATGGAGGCCAGGAAAGG + Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1069977979 10:72231082-72231104 GCAGAAATGAAGGCCTGGTGAGG - Intronic
1070010350 10:72467471-72467493 ACAGAAAATTAGGCCGGGAGTGG - Intronic
1071729414 10:88233003-88233025 GCAGAAACGGAGGCCCAGAGAGG + Intergenic
1072343416 10:94478416-94478438 CTGGAAATGTAGGCCAGGCGTGG + Intronic
1075547708 10:123367886-123367908 CCTGAAAACTAGGCCGGGAGCGG + Intergenic
1076150943 10:128161578-128161600 CAGGAAATGGAGGCCCGGAGAGG - Intergenic
1078101336 11:8332056-8332078 GTACAAATGGAGGCCCGGAGAGG + Intergenic
1078901422 11:15646166-15646188 GCAGAAATGGAGGCGCAGAGAGG + Intergenic
1083295265 11:61711873-61711895 GAAGAAATGGAGGCCCAGAGAGG - Intronic
1083585006 11:63850613-63850635 CCAGAAATATAGGCAGGCAGTGG - Intronic
1083659275 11:64244809-64244831 CCAGAAATGAAGGCCTGGATGGG + Exonic
1084382425 11:68821441-68821463 ACAAAAATGTAGGCCGGGCGCGG - Intronic
1084982717 11:72839956-72839978 ACAGAAAGGTAGGACCAGAGAGG + Intronic
1088491362 11:110391263-110391285 CCAGAAATACAGGCCAGGCGTGG + Intergenic
1089504977 11:118956823-118956845 CCAGATCTGTTGGCCAGGAGGGG + Intronic
1090606011 11:128423494-128423516 GAAGAAATGTAGGCTCAGAGAGG + Intergenic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1090991109 11:131817716-131817738 TCAGAAAGGTAGGACCAGAGGGG - Intronic
1091801352 12:3326632-3326654 TGAGAAATGCAGCCCCGGAGAGG + Intergenic
1091847864 12:3671150-3671172 GCAGAAATGCAGGCCAGCAGAGG + Intronic
1092144710 12:6206512-6206534 TAAGAAATGTAGGCCAGGCGCGG - Intronic
1095141920 12:38674219-38674241 CCAGAAATATATGCCAGGAAGGG + Intronic
1095245111 12:39910792-39910814 TCAGAAATGTAGGCCAGGTGTGG + Intronic
1096142855 12:49256887-49256909 ACAGTAATTTAGGCCAGGAGCGG + Intronic
1096798110 12:54091149-54091171 GAAGAAATGGAGGCCCAGAGAGG + Intergenic
1097712466 12:62932247-62932269 GCGGAAATGGAGGCCCAGAGAGG + Intronic
1098690684 12:73483331-73483353 CAAGAAATGGAGGCCGGGTGTGG - Intergenic
1098979971 12:76945435-76945457 TAAGAAATGTAGGCCAGGCGCGG - Intergenic
1099728464 12:86465916-86465938 ACCTAAATGTAGGCCGGGAGTGG + Intronic
1100437745 12:94587301-94587323 TCAGAAATGGAAGCCCGTAGAGG - Intronic
1101865395 12:108516243-108516265 CCAGAAATGGAAGGCCAGAGAGG + Intronic
1102584877 12:113915718-113915740 GAAGAAATGGAGGCCCAGAGCGG - Intronic
1106195733 13:27492413-27492435 ACAGAAATTTAGGCCAGGCGTGG - Intergenic
1107871736 13:44752923-44752945 CAGGAAATGGAGGCCCAGAGAGG + Intergenic
1109418012 13:62069792-62069814 TAAGAAATGTGAGCCCGGAGAGG + Intergenic
1112135390 13:96573136-96573158 CCAGCCAAGTAGGTCCGGAGAGG - Intronic
1112296404 13:98191075-98191097 CCAGCAGTGTCGGGCCGGAGAGG - Intronic
1113748008 13:112758711-112758733 TAAGAAATGTAGGCTGGGAGCGG - Intronic
1113902998 13:113806801-113806823 CCAGAACTGGAGGCCCGCAGGGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1117342663 14:54805318-54805340 GGAGAAATGGAGGCACGGAGAGG - Intergenic
1117927169 14:60794372-60794394 ATAGAAATATAGGCCAGGAGTGG + Intronic
1120155410 14:81088042-81088064 CCAGAAAAGTAGGATGGGAGAGG - Intronic
1121038629 14:90727090-90727112 CCAGAAAGGGAGGCCGGGAGAGG + Intronic
1122255696 14:100474012-100474034 CCAGAAGTGAAGGCTCAGAGGGG + Intronic
1123495133 15:20816598-20816620 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1123551625 15:21385691-21385713 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1126161352 15:45616565-45616587 CCAGAAATGCAGGCCCAGGAAGG - Intronic
1127062538 15:55201652-55201674 CAAGAAATCTAGGCCAGGTGTGG - Intergenic
1128964808 15:72048107-72048129 CCAGCCATATAGGCCAGGAGTGG + Intronic
1129199360 15:73989705-73989727 TGAGAAATGAAGGCCCAGAGAGG + Intronic
1131264673 15:90908939-90908961 CTAGAAATGGAGGCTCAGAGAGG + Intronic
1202959967 15_KI270727v1_random:112933-112955 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1132528007 16:426864-426886 CCAGAAATCCAGGGCCGAAGTGG - Intronic
1133844929 16:9444817-9444839 CCAGGAATGGAGGCACTGAGTGG + Intergenic
1134679260 16:16112580-16112602 ACAGAAACTGAGGCCCGGAGAGG + Intronic
1136001387 16:27296832-27296854 CCACAGATGTAGGCCAGGCGCGG - Intergenic
1136172939 16:28499243-28499265 CCAAAAATGTAGGAGCAGAGAGG + Intergenic
1137389040 16:48066376-48066398 CCAGAATTGAAGGGCAGGAGAGG - Intergenic
1138598700 16:58042684-58042706 ACAGAAATCTGGCCCCGGAGTGG - Intronic
1140225353 16:73072158-73072180 TCAGAAATGTAGGCCAGGTGGGG + Intergenic
1140948315 16:79791973-79791995 GCAGAAATGGAGGCCTGGAGTGG - Intergenic
1141242316 16:82275177-82275199 CAAGAAAGGTAGGCCGGGCGTGG + Intergenic
1141753992 16:85979153-85979175 GCAGAAATGAAAGCCCAGAGAGG - Intergenic
1141817804 16:86424950-86424972 GCAGGAATGTGGGCCTGGAGAGG - Intergenic
1142642399 17:1291918-1291940 CAGGAAATGTAGGCCAGGCGCGG + Intronic
1143400486 17:6639596-6639618 CCAGAGCTGTGGGCCCTGAGGGG + Intronic
1144525262 17:15983875-15983897 CAAGAATTATAGGCCGGGAGTGG - Intronic
1144963267 17:19058955-19058977 ACAGAAATGTAGGCCGGGCATGG + Intergenic
1144964423 17:19067085-19067107 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144971892 17:19115570-19115592 ACAGAAATGTAGGCCGGGCATGG - Intergenic
1144983545 17:19185088-19185110 CCAGAAATGTAGGCCGGGCATGG + Intergenic
1144984680 17:19193151-19193173 CCAGAAATGTAGGCCGGGCATGG - Intergenic
1145082573 17:19907307-19907329 CCAGAAATGGGGGCCGGGCGTGG - Intronic
1146012576 17:29207592-29207614 CCAGAAAAGAAGGCCAGGTGTGG - Intergenic
1146035779 17:29405486-29405508 CCACAAGTTTAGGCCAGGAGTGG + Intronic
1146102749 17:30001041-30001063 CCAGAAATGCAAGCCACGAGAGG - Intronic
1146669848 17:34729494-34729516 CAAGAAATGGAGGCACAGAGAGG - Intergenic
1151674680 17:75591343-75591365 CCAGAACTGTAGCCCAGCAGTGG - Intergenic
1152460652 17:80440442-80440464 CATGAAATGTAGGCAGGGAGCGG - Intergenic
1153643748 18:7176464-7176486 CGAGAAATGTGGGCCGGGCGCGG - Intergenic
1154070955 18:11150476-11150498 CCAGGAATGTAGGTGCGGAAGGG - Intergenic
1154452532 18:14489072-14489094 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1155214268 18:23629273-23629295 ACAGAAATGTAGTCTGGGAGTGG - Intronic
1156495111 18:37520392-37520414 GTAGAAATGAAGGCCCAGAGAGG + Intronic
1160903021 19:1438613-1438635 CCGGACATGAAGGCCCGGACAGG - Intronic
1161044121 19:2125710-2125732 ACAGAAATGTAGGCCGGGCGCGG + Intronic
1161859025 19:6783928-6783950 CCAGAAATGCAGGTATGGAGCGG + Intronic
1162675839 19:12297515-12297537 CCTGAAATGGAGCCCCAGAGTGG + Intergenic
1162825059 19:13246185-13246207 CAGGAAATGGAGGCCCAGAGAGG - Intronic
1164675221 19:30096068-30096090 CTAGAAATATAGGCCGGGTGCGG + Intergenic
1165241759 19:34474409-34474431 CCAAAAATGTGGGCCAGGTGAGG + Intergenic
1167281507 19:48571972-48571994 CAAGAAATGGAGGCCCAGAGAGG - Intronic
1167751575 19:51383725-51383747 GAAGAAATGGAGGCCCAGAGAGG + Intronic
925115015 2:1371321-1371343 CAAGAACTATGGGCCCGGAGGGG - Intergenic
932837498 2:75051061-75051083 CCAGGAATGGGAGCCCGGAGTGG - Intronic
934018819 2:87922001-87922023 CCAAAAAAGTAGGCCCGGCACGG + Intergenic
934535384 2:95129039-95129061 ACGGAAGTGTAGGCCCAGAGTGG - Intronic
936041178 2:109150669-109150691 CCAGAAATGTAGAGCCAGACTGG - Intronic
938052856 2:128190974-128190996 CCAGCAAAGTATGCCCTGAGGGG - Exonic
938761590 2:134431071-134431093 CCAGATGTGAAGGCCTGGAGGGG + Intronic
939261787 2:139820199-139820221 CCAGAAATTTAGGCACTCAGAGG - Intergenic
940076933 2:149751957-149751979 ACAGACATGTAGGCCAGGTGTGG - Intergenic
941031515 2:160516941-160516963 ACAGAAACGTAGGGCTGGAGAGG + Intergenic
944799114 2:203219563-203219585 CCAAAAATGTGGGCCGGGTGTGG + Exonic
946027338 2:216679723-216679745 CCAGAAATGTAGGCCCGGAGGGG + Intronic
948389543 2:237602078-237602100 CCATCAATGGAGGCCCCGAGGGG - Intergenic
1168966552 20:1901967-1901989 CCAGAAATGGAAGCCCGTGGTGG + Intronic
1169535303 20:6532578-6532600 CCACAAATGTGGGCCCAGTGTGG - Intergenic
1174578270 20:51553106-51553128 ACGGGAATGTAGGCCTGGAGTGG - Intronic
1175141572 20:56864728-56864750 CCAGAGATCTAGACCCAGAGAGG + Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1176443494 21:6799212-6799234 CCCAAAATGCAGGCCCAGAGTGG + Intergenic
1176821663 21:13664259-13664281 CCCAAAATGCAGGCCCGGAGTGG + Intergenic
1181101611 22:20544373-20544395 ACAGAAATTTAGGCCGGGTGCGG + Intronic
1181466652 22:23113996-23114018 CCACAAAGGGAGGCCCAGAGGGG + Intronic
1184435236 22:44469626-44469648 CCAGAAAAATAGGCCAGGCGTGG - Intergenic
1184747750 22:46465851-46465873 CCAGAAACGCAGGCCCGGCTGGG + Intronic
953668109 3:44940468-44940490 CCAGAAAGGAATGCCAGGAGAGG - Intronic
954068173 3:48123558-48123580 CAAGAAATGTATGCCAGGTGCGG - Intergenic
954166171 3:48760065-48760087 ACAAAAATGTAGGCCAGGTGTGG + Intronic
956384924 3:68706324-68706346 TCAGAAATGATGGCCCAGAGTGG - Intergenic
956625327 3:71260830-71260852 CTAGAACTGTAGGCCGGGCGTGG - Intronic
957719698 3:83978017-83978039 CCAGGATTTTAGGCCCAGAGTGG - Intergenic
957898962 3:86463136-86463158 CCAGAAATGAAGGGCCTTAGAGG + Intergenic
961364977 3:126394011-126394033 CCAGCAATGTAGTCCCAGTGAGG - Intergenic
961481084 3:127181179-127181201 GCAGAAAGGTAGGCCTGGAGGGG + Intergenic
966482807 3:180430209-180430231 CAAGAAATGTTGGCCGGGCGCGG + Intergenic
966874690 3:184315229-184315251 CCAGGAGTGTAGGCCAGGAAGGG - Intronic
967364148 3:188666762-188666784 CCAGAAATGTAAGCACCCAGAGG - Intronic
969444309 4:7235395-7235417 CAAGAAATGGAGGCTCAGAGAGG + Intronic
969712426 4:8851709-8851731 GGAGAAATGGAGGCCCCGAGAGG - Intronic
974364453 4:60928041-60928063 CCAAATATGTAGGCCAGGTGTGG + Intergenic
975827214 4:78332264-78332286 CCAGGAATGTAGCCCCGGGAGGG + Intronic
980908511 4:138972667-138972689 CCAGAAATGGAGGCCAAGTGTGG - Intergenic
984427836 4:179610548-179610570 GCAGAACTGTAGGTCTGGAGGGG + Intergenic
985943668 5:3159958-3159980 CTAGAAAAGTAGACCCGGATTGG + Intergenic
987075701 5:14380083-14380105 CCAGAAATGGAGGCCTGGGCTGG - Intronic
987867918 5:23570902-23570924 CAAGAAATTTAGGCCAGGTGTGG + Intergenic
988509978 5:31856490-31856512 CCAGCAATGCAGGCTCAGAGAGG - Intronic
990743553 5:58936361-58936383 AAAGATATGTAGGCCGGGAGCGG - Intergenic
992643327 5:78788920-78788942 ACAAAAATGTAGGCCAGGTGTGG - Intronic
993273161 5:85820767-85820789 TAAGAAATCTAGGCCGGGAGCGG - Intergenic
999097395 5:148992192-148992214 GCAGAAATGGAGGCCCAGAATGG + Intronic
1001778100 5:174344297-174344319 CTGGAAATGGAGGCCCAGAGAGG - Intergenic
1002053741 5:176586557-176586579 GCGGAAATGGAGGCCCAGAGAGG - Intronic
1002789104 6:424778-424800 GCAGAAAGGAAGGCCCGGCGGGG - Intergenic
1003353544 6:5343500-5343522 ACTGAAATGTAGGCCAGGCGCGG - Intronic
1003384215 6:5652529-5652551 GCAGAAATGAAGGCCCAGTGCGG + Intronic
1007409825 6:41655061-41655083 CCAGGAATGAAGGCTTGGAGTGG + Intergenic
1007461043 6:42019195-42019217 AAGGAAATGTAGGCCTGGAGCGG + Intronic
1016386791 6:143537180-143537202 CCGGAGATGTGGACCCGGAGCGG - Intronic
1016643978 6:146381911-146381933 TCAGAAATGTAGTCCCAAAGTGG + Intronic
1017024985 6:150173733-150173755 CTAGGAATGGAGGCCCGCAGAGG + Intronic
1017375954 6:153767984-153768006 TCTGAAATGTCGGCCAGGAGCGG - Intergenic
1023398822 7:39776375-39776397 AAAGAAATGGAGGCCCGGAGTGG - Intergenic
1024447444 7:49497800-49497822 CCAGAAATGCAGGTCCCAAGAGG - Intergenic
1024651615 7:51408310-51408332 AAAGAAATGGAGGCCCAGAGTGG + Intergenic
1025133823 7:56394115-56394137 AAAGAAATGGAGGCCCGGAGTGG + Intergenic
1026466897 7:70662064-70662086 CCAGAGATGTGGGCCAGGTGGGG + Intronic
1026819035 7:73534411-73534433 ACAAAAATGTAGGCCGGGCGTGG - Intergenic
1027656739 7:80940083-80940105 CTAGAAATGTTGGCCGGGCGCGG - Intergenic
1028914157 7:96240473-96240495 CCAGAAATGGTGGTCCAGAGGGG + Intronic
1035628410 8:1090522-1090544 CCAGAAATTCAGGGCCTGAGTGG + Intergenic
1036768210 8:11562410-11562432 CGAGAAATGGAGGCCAGGGGAGG + Intronic
1038010616 8:23472898-23472920 CTAGAAATTGAGGCCCGGAGAGG - Intergenic
1038015112 8:23508226-23508248 ACAGAAATGGCGGCCCAGAGAGG + Intergenic
1040779702 8:51093295-51093317 GCAGAAATTTAGGCCTGGTGCGG - Intergenic
1043418110 8:80072018-80072040 TAAGAAATGTAGGCCGGGCGCGG + Intronic
1044551384 8:93516441-93516463 TCAGAAATGTAGGGACGCAGTGG + Intergenic
1047435845 8:124834924-124834946 CCAGAAACCAAGGCCTGGAGGGG - Intergenic
1047502621 8:125453977-125453999 CTAGAAATGGAGGCCCAGAGAGG + Intergenic
1048566873 8:135609583-135609605 TCAAAAAGGTAGGCCCGGTGTGG - Intronic
1049605010 8:143525314-143525336 CCAGAAAGGAGGGCCCTGAGGGG + Intronic
1049844452 8:144793143-144793165 CAAGAAATGGAGGCTGGGAGGGG + Intergenic
1050471147 9:5991854-5991876 GCAGAAAATTAGGCCTGGAGAGG - Intronic
1051191020 9:14513337-14513359 ACAGAAATGAAGGCCGGGTGTGG + Intergenic
1051355300 9:16234874-16234896 CCAGAAATGTGTGCCCTCAGAGG + Intronic
1053144826 9:35705318-35705340 CCAGAAAGGCAGGCCCGGGAAGG + Intronic
1053292490 9:36890530-36890552 CCAGAAACCAAGGCCCAGAGAGG - Intronic
1053410606 9:37914070-37914092 CCAGAAATGGAGGCCCAGACAGG - Intronic
1053787712 9:41664262-41664284 GAAGAAATGGAGGCCCAGAGAGG + Intergenic
1054157414 9:61650505-61650527 GAAGAAATGGAGGCCCAGAGAGG - Intergenic
1054175988 9:61875604-61875626 GAAGAAATGGAGGCCCAGAGAGG + Intergenic
1054477188 9:65581510-65581532 GAAGAAATGGAGGCCCAGAGAGG - Intergenic
1054661551 9:67705204-67705226 GAAGAAATGGAGGCCCAGAGAGG - Intergenic
1056947164 9:91007907-91007929 TCAGAAATGGAGGTCAGGAGGGG + Intergenic
1057075138 9:92134639-92134661 CCAGAAAGGTGGGCAGGGAGGGG + Intergenic
1059355027 9:113692120-113692142 ACAGAAATGCAGGCCGGGCGTGG - Intergenic
1059717680 9:116928999-116929021 CCAGAAATGCAGGCCACGACAGG - Intronic
1061324976 9:129858184-129858206 CCAGCCATTTAGGCCCAGAGTGG - Intronic
1061772298 9:132935254-132935276 TCAGAAATGTAGACGGGGAGAGG - Intronic
1203525706 Un_GL000213v1:85315-85337 CCCAAAATGCAGGCCCGGAGTGG - Intergenic
1186212956 X:7269335-7269357 ACAGAAATGTATGGCTGGAGAGG - Intronic
1189067796 X:37829587-37829609 TCAGCAATGTAGGCTGGGAGTGG - Intronic
1189217425 X:39338175-39338197 TAAGAAATGTAGGCACAGAGAGG + Intergenic
1191995471 X:67090726-67090748 ACAGAAATGTAGGCCAGGTCTGG + Intergenic
1195247313 X:103006058-103006080 CGAGAAGTGGAGGCCCAGAGTGG - Intergenic
1199125709 X:144117135-144117157 CCAAAAAAGTAGGCCCGGCACGG - Intergenic