ID: 946027990

View in Genome Browser
Species Human (GRCh38)
Location 2:216683672-216683694
Sequence GAGAGGTTTTTGCAGAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946027981_946027990 8 Left 946027981 2:216683641-216683663 CCAGACTTCCCCGCCCATGAGAT 0: 1
1: 0
2: 0
3: 7
4: 91
Right 946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG 0: 1
1: 0
2: 1
3: 24
4: 230
946027983_946027990 -1 Left 946027983 2:216683650-216683672 CCCGCCCATGAGATGCTGTTCTG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG 0: 1
1: 0
2: 1
3: 24
4: 230
946027982_946027990 0 Left 946027982 2:216683649-216683671 CCCCGCCCATGAGATGCTGTTCT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG 0: 1
1: 0
2: 1
3: 24
4: 230
946027984_946027990 -2 Left 946027984 2:216683651-216683673 CCGCCCATGAGATGCTGTTCTGA 0: 1
1: 0
2: 0
3: 10
4: 130
Right 946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG 0: 1
1: 0
2: 1
3: 24
4: 230
946027986_946027990 -6 Left 946027986 2:216683655-216683677 CCATGAGATGCTGTTCTGAGAGG 0: 1
1: 0
2: 2
3: 17
4: 235
Right 946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG 0: 1
1: 0
2: 1
3: 24
4: 230
946027985_946027990 -5 Left 946027985 2:216683654-216683676 CCCATGAGATGCTGTTCTGAGAG 0: 1
1: 0
2: 1
3: 22
4: 168
Right 946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG 0: 1
1: 0
2: 1
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946027990 Original CRISPR GAGAGGTTTTTGCAGAGGAT GGG Intronic
900565652 1:3330701-3330723 GAGAGGTTGTTGGGGAGGGTGGG + Intronic
901221811 1:7587728-7587750 GAGAGGTTCCTGCAGAAGCTGGG - Intronic
903166014 1:21520974-21520996 GAGAGGTTGCTGCAGGGGAGGGG - Intronic
905929833 1:41779228-41779250 GAGAGGTGTCTGCAGTGGAGTGG + Intronic
908167349 1:61471526-61471548 GAGAGGATTTTGGAGAAGATTGG - Intergenic
908845154 1:68316920-68316942 GGGAGGTTGAGGCAGAGGATTGG + Intergenic
910914947 1:92278672-92278694 GAGGGATTTTTAGAGAGGATGGG - Intronic
910956226 1:92709155-92709177 GAGAAGTTTTGACAGAGGGTGGG + Intronic
913316254 1:117555551-117555573 GAGAGGAGTTTTCAGTGGATAGG + Intergenic
916471639 1:165129228-165129250 GAAAGAGTTTTGCAGAGGAATGG + Intergenic
917689079 1:177449018-177449040 GAGAGGTGTGTGCAGAGGTGGGG - Intergenic
917739675 1:177950419-177950441 ATTAGGTTTGTGCAGAGGATGGG - Intronic
918168028 1:181969443-181969465 GTGATGTTTTGGCAGAGGCTTGG + Intergenic
918272776 1:182919446-182919468 GGGAGGTATTTCAAGAGGATAGG - Intronic
919803569 1:201367644-201367666 GAGAGGGTTTGGGAGAGGAGAGG - Intronic
921885770 1:220303668-220303690 GAGAGGTTTTAACTGAGGGTAGG - Intergenic
924768660 1:247058787-247058809 TGGAGGTTTTTTCAAAGGATTGG - Intronic
1062954431 10:1530680-1530702 GAGAGGAGTTTGGAGAGTATGGG - Intronic
1064932263 10:20640838-20640860 GAGAGGAGGTTGCAGATGATTGG + Intergenic
1064935921 10:20679040-20679062 GTGAGCTTTGTCCAGAGGATGGG - Intergenic
1065770411 10:29072836-29072858 CAGATTTTTTTTCAGAGGATGGG + Intergenic
1067163782 10:43848791-43848813 GAGAAGTTTTCTCAGAGGACAGG + Intergenic
1068410918 10:56653406-56653428 GGGAGCTTTTTGAAGAGGAGGGG + Intergenic
1069030298 10:63589095-63589117 GAGGGGTTTGAGCAGAGGAATGG + Intronic
1069682594 10:70295957-70295979 GAGAGGTCTTTTCACAGGAATGG + Intergenic
1072724691 10:97805162-97805184 GAGAGGTTTTTGCTGGGCACGGG - Intergenic
1073871789 10:107872988-107873010 GAGATGAATTTGCAGAAGATGGG - Intergenic
1075044156 10:119132955-119132977 GGGAGGTTGTTGCTGAGCATGGG + Intronic
1076804355 10:132847649-132847671 GAGAGGTGTTTCCAAAGGACAGG - Intronic
1079714174 11:23723871-23723893 TAGAGGCTTTGGGAGAGGATTGG + Intergenic
1080539634 11:33254048-33254070 GAGGGGTTTTTGAAGAGGCTAGG + Intergenic
1080735552 11:35010459-35010481 GTGAGATCTTTGCAGAGGAAAGG - Intronic
1081627827 11:44666107-44666129 GAGATGTTCCTGCTGAGGATGGG + Intergenic
1081644616 11:44781064-44781086 TAGAGGTTTCTGCAGAGGGCCGG + Intronic
1082209754 11:49484316-49484338 GGGAGGTGGTTGCAGAGTATTGG + Intergenic
1082723457 11:56706713-56706735 GTGAGGTCTTTACAGAGGGTTGG - Intergenic
1082737888 11:56876563-56876585 GAAGGCTTTTTGGAGAGGATAGG + Intergenic
1082869704 11:57932845-57932867 TAGAGCTATTTGGAGAGGATGGG - Intergenic
1084026152 11:66451006-66451028 GAGAGGAAGTTGGAGAGGATGGG + Intronic
1084557737 11:69884893-69884915 GAGAGGTCATTGCAGTGCATTGG + Intergenic
1086167958 11:83801368-83801390 GAAAGATTTTAGCAGAGGAGAGG - Intronic
1086247264 11:84768816-84768838 GAGAGATTCTTGGAGAGGGTAGG - Intronic
1086599906 11:88620309-88620331 TAGAGGCTTTTGCACAGAATAGG - Intronic
1086639920 11:89141220-89141242 GGGAGGTGGTTGCAGAGTATTGG - Intergenic
1088534526 11:110846120-110846142 GACATGATTTTGCAGAGAATGGG - Intergenic
1090097131 11:123753504-123753526 GAGAGGATTTTGGAGAAGTTTGG - Exonic
1090199706 11:124845572-124845594 GAGAGGATTAGGCAGAGGAGAGG + Intergenic
1090248027 11:125230559-125230581 CAGAGGGCTTTGCAGAGGACAGG + Intronic
1090745947 11:129704911-129704933 GAGAGGCAGGTGCAGAGGATGGG + Intergenic
1091387713 12:105246-105268 GAGAGGTCTTTGGAGAGGTTGGG + Intronic
1092409755 12:8243760-8243782 GAGGGGTTTGAGGAGAGGATCGG + Intergenic
1096000107 12:48122369-48122391 GATAGGTTATTGCAGAGGGCTGG - Intronic
1097978864 12:65716540-65716562 GAGAGGTTTCTGCTAAAGATAGG + Intergenic
1099095541 12:78370685-78370707 GAGAGTTTTGAGCAGAGGAATGG - Intergenic
1099225567 12:79964796-79964818 GAGAGCTTATTGCAGTGGAGGGG - Intergenic
1099975553 12:89542348-89542370 GAGCGGGTTGTGAAGAGGATAGG + Intergenic
1100091280 12:90974426-90974448 GAGAGGTTTGTGAAGAGCAAGGG + Intronic
1101404634 12:104417125-104417147 GAGAGCTTTGTTCAGAGGAGAGG + Intergenic
1102433582 12:112902537-112902559 GAGACCTTTTTGCTGAGGACAGG + Intergenic
1105676210 13:22674912-22674934 GAGAGGTTTTTGGAGATGTCAGG + Intergenic
1108884623 13:55164959-55164981 TAGAGGTTTTGGCAGAGGAATGG + Intergenic
1110463103 13:75768737-75768759 GAAAGGTTTTTGTAGAGCTTAGG + Intronic
1112090414 13:96077461-96077483 GAGAAGTTTAGGCTGAGGATAGG + Intergenic
1114938192 14:27571449-27571471 CTGAGGTTATTTCAGAGGATAGG - Intergenic
1117523678 14:56576236-56576258 TACAGGTTATTGGAGAGGATGGG - Intronic
1117654720 14:57943207-57943229 CAGTGGTTTTTGCACAGAATTGG + Intronic
1118093663 14:62511992-62512014 GAGAGGTGATAGCAGAGGCTAGG + Intergenic
1120878638 14:89397479-89397501 TAGAGGTTCTTGCAGAGCCTCGG - Intronic
1120900072 14:89568066-89568088 GATAGGTTTTAGGGGAGGATAGG - Intronic
1121550278 14:94794234-94794256 GAGAAATTTTTCCAGATGATAGG - Intergenic
1121936331 14:98022721-98022743 AAGAGGCTTTTGCAGAGCAGCGG - Intergenic
1126546500 15:49879916-49879938 GAGAGGTTTTTGCGGGGGAGTGG + Intronic
1126672399 15:51128119-51128141 ATGAGGTTTTGGCAGAGGTTTGG + Intergenic
1126691375 15:51291306-51291328 GAGAGGTGTTTCCAGAGAAATGG + Intronic
1127213764 15:56802609-56802631 GTGAGGTGTTTGCAGGGGAAGGG - Intronic
1129691091 15:77714023-77714045 GAGAGGTCTTTATAGGGGATGGG - Intronic
1129785724 15:78308920-78308942 GTCAGGTATGTGCAGAGGATGGG - Intergenic
1130076820 15:80696195-80696217 GCGCGGTTTTTGGAGAGGGTGGG - Intronic
1131158346 15:90088648-90088670 GGGATGTTTTTGCAGATGATGGG + Exonic
1134749301 16:16613301-16613323 AAGATGTTCTTGCAGAAGATGGG - Intergenic
1134827225 16:17294499-17294521 GAGATGTTTATTCAGAGCATGGG + Intronic
1134996170 16:18740322-18740344 AAGATGTTCTTGCAGAAGATGGG + Intergenic
1139355357 16:66364309-66364331 GAGAGGTTGGAGCAGAGGCTGGG + Intergenic
1141288423 16:82694578-82694600 CAGAGGTTTTAGAAGATGATTGG - Intronic
1141507158 16:84485408-84485430 GAGAGCTTTCAGCAGAGGCTAGG - Intronic
1141882708 16:86870342-86870364 TAGAGGGTTGTGCAGAGGGTAGG - Intergenic
1142944956 17:3418315-3418337 GAGAGGTTTTTGCTGGGGACAGG + Intergenic
1143949028 17:10618407-10618429 GAGAGGGTTTTCCAGAGCACAGG + Intergenic
1145994996 17:29099961-29099983 GGGAGGTTTTGGCAGGGGAGGGG + Intronic
1146680476 17:34803841-34803863 GAGAGGTTTCTGCATAAGAGAGG + Intergenic
1147181302 17:38687516-38687538 GAGAGGTTTTCTTAGAGGAAGGG - Intergenic
1148829594 17:50422686-50422708 GAAAGGTTTTTGGAGATGAATGG - Intergenic
1149229906 17:54520796-54520818 GAGTGGGTTTTGCAGAGGATGGG - Intergenic
1149375751 17:56042419-56042441 GAGAGTTTTGAGCAGAGGAGCGG + Intergenic
1151273365 17:73014092-73014114 GAGTGGGCTCTGCAGAGGATGGG - Intronic
1151958960 17:77394979-77395001 GAGATGTTTTTCCAGAGGTGGGG + Intronic
1152260082 17:79262130-79262152 GAGAGGCTTTTCCAGAGCAGTGG - Intronic
1153028781 18:694087-694109 GAGAGGTTTTGGCAGTAGGTAGG - Intronic
1153121008 18:1727195-1727217 AAGAGGTTTTTGGACAGCATTGG + Intergenic
1153344656 18:4012398-4012420 CAGATGTTTTTGCAGTGGCTGGG - Intronic
1155491824 18:26407482-26407504 CAGAGGTTTGTTCAGAGGAAGGG + Intergenic
1155713721 18:28913431-28913453 GAGAAGTTTTTACAGAGGGAAGG - Intergenic
1157095476 18:44682276-44682298 AAGAGGTATTTGGAGAGGAAGGG + Intronic
1157186276 18:45542760-45542782 GTGAGGTTTCTGCAGTGGAAGGG + Intronic
1157927071 18:51778302-51778324 GAGAGGTTCTTTCAGAAGAATGG + Intergenic
1160872065 19:1282186-1282208 GAGAGGAGGGTGCAGAGGATGGG + Intergenic
1161942689 19:7415494-7415516 GAAAGGTTTATGTGGAGGATTGG - Intronic
1162004225 19:7766877-7766899 GAGAGGATTTTGCAGAAGAGGGG + Intronic
1164001298 19:21101882-21101904 GAGTGTTTTTTTCAGAGGACAGG - Intronic
1164682618 19:30145735-30145757 GAGAGGTTTTAGCAGTGGGTTGG + Intergenic
1166565843 19:43765086-43765108 GAGAGCTTCTTGCAGGGGAAGGG + Intergenic
1167406182 19:49310219-49310241 GAGGGGATTTGACAGAGGATTGG + Intronic
1202651951 1_KI270707v1_random:13721-13743 TGGAAGATTTTGCAGAGGATTGG - Intergenic
925384721 2:3454190-3454212 GAGTGCTTTTTGCAGAGGGAGGG + Intronic
926036636 2:9640935-9640957 GTGAGGTTGTTGCTGAAGATTGG + Intergenic
927223704 2:20740231-20740253 GAGAGGTTTTCTTAAAGGATAGG + Intronic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
928396634 2:30947655-30947677 GGGTGGTTGGTGCAGAGGATTGG - Intronic
928844226 2:35650361-35650383 AAAAGATTTTTGCATAGGATTGG - Intergenic
931903756 2:66820791-66820813 GAGAGGTCATTGCAGAGAATGGG + Intergenic
933022848 2:77216775-77216797 GAGAGGTTTTTGAAAAGGCTGGG + Intronic
934583167 2:95463738-95463760 GAGAGGTTTTTGCTGATTCTGGG + Intergenic
934596283 2:95612976-95612998 GAGAGGTTTTTGCTGATTCTGGG - Intergenic
936740204 2:115496734-115496756 AACTGGTTTTTGCAGTGGATAGG - Intronic
936914894 2:117630272-117630294 GAGATGCTTTTGCAGACCATTGG + Intergenic
936947561 2:117944351-117944373 CATAGGTTTTTGCAGGGGAAGGG - Intronic
936998040 2:118435785-118435807 GAGAGGGTTGAGCAGAGGGTGGG + Intergenic
937309297 2:120892253-120892275 GAGAGGTTTCTGCAGGTGGTGGG + Intronic
940033159 2:149286026-149286048 AAGAAATTTTTGCAGAGGCTTGG - Intergenic
942134343 2:172910248-172910270 TAGAGGTTATTGGAGAGGATTGG - Intronic
942452078 2:176114679-176114701 GAAAGGTTTTTGTAAAGGAGCGG + Intronic
944268837 2:197759227-197759249 GAGAAGGGTTTGCAGAGGCTGGG - Intronic
945916911 2:215713951-215713973 GAAAGGAATTTACAGAGGATTGG - Intergenic
946027990 2:216683672-216683694 GAGAGGTTTTTGCAGAGGATGGG + Intronic
1168876870 20:1177868-1177890 GAGAGTTTTGAGCAGAGGAGTGG + Intronic
1168898713 20:1341892-1341914 AAGGGGTTTTTGCACAGGCTGGG - Intronic
1168914961 20:1478055-1478077 GAGAAGGTTTTACAGAGGAAGGG + Intronic
1168957746 20:1846435-1846457 GAGTGGTTCTGGCAGAGGAAGGG + Intergenic
1169612829 20:7402226-7402248 CAAAGGTTTGTGTAGAGGATGGG + Intergenic
1171195906 20:23199163-23199185 GAGAGGATTTTACAGAAGACAGG + Intergenic
1172615674 20:36282119-36282141 GAGAGGATTAGGCAGAGGAGAGG + Intergenic
1172950574 20:38720986-38721008 GAGAGGATTTTGCAGTAGACTGG - Intergenic
1174710577 20:52700710-52700732 GAGAGGTTTGTGGAGAGGAGGGG - Intergenic
1175481505 20:59314483-59314505 GAGAGGTGTTAGGACAGGATTGG + Intronic
1177007631 21:15693366-15693388 TAAACGTTTTTGCAGAGGAAAGG + Intergenic
1177635927 21:23786211-23786233 GAGAGACTTTTTCAGAGGAGGGG - Intergenic
1180418174 22:12788596-12788618 TGGAAGATTTTGCAGAGGATTGG - Intergenic
1181845783 22:25707726-25707748 GAGAGTTTTGAGCAGAGGAGTGG + Intronic
1182175798 22:28286985-28287007 AAGATGTTTTAGCAGAGGAAAGG + Intronic
1184108316 22:42381414-42381436 GAGATGTTTCTGCAGAGGGGAGG + Exonic
1184400081 22:44268657-44268679 GAGAGGGTGTTTTAGAGGATGGG + Intronic
949359597 3:3217545-3217567 GAGAGGTATTTGCAGTGGAGAGG - Intergenic
950416879 3:12873884-12873906 GAGATGTGTCTGCAGAGCATTGG + Intergenic
952096204 3:29957491-29957513 GAGAGCTTTCTGAAGGGGATAGG + Intronic
953413080 3:42701149-42701171 GAGCGGTTTTGGCAGAGGGTGGG - Intronic
955914020 3:63888152-63888174 AAGAGATTTTTACAGAGGCTTGG + Intronic
956536404 3:70281750-70281772 GAGAAAGCTTTGCAGAGGATGGG - Intergenic
960299904 3:115989979-115990001 GATAGATTGTTGCATAGGATTGG + Intronic
960312538 3:116133987-116134009 TAGAGGTTTTTGAAGAAGCTGGG + Intronic
961187697 3:124930176-124930198 GAGAGGTTTTTGCAGGTCTTTGG + Intronic
961465654 3:127079464-127079486 GAGGGGTTTCTGGAGAGCATGGG + Intergenic
963942135 3:151105875-151105897 GGGGGCTTTTTGCAGAGGAAGGG - Intronic
964185535 3:153938215-153938237 AGCAGGTTTTTTCAGAGGATGGG + Intergenic
965406940 3:168281319-168281341 AAGAGTTTTTTGCAAATGATGGG - Intergenic
968740721 4:2330514-2330536 GAGAGGACATTGCAGAGGAAGGG + Intronic
968870373 4:3239059-3239081 GTGGGGTTTTTGCAAAGGTTAGG - Intronic
969536351 4:7758267-7758289 GTGGGGTTTTTGCAGAGGAGTGG - Intergenic
971767268 4:30849235-30849257 GAGTGGTTTTTGGAGGGGAGAGG - Intronic
973363613 4:49188691-49188713 TGGAAGATTTTGCAGAGGATTGG + Intergenic
973397475 4:49608175-49608197 TGGAAGATTTTGCAGAGGATTGG - Intergenic
973757311 4:54088221-54088243 TAGACGGATTTGCAGAGGATGGG - Intronic
974730565 4:65859487-65859509 CAGAAGTTTTTTCAGAGGAAAGG - Intergenic
976750044 4:88444438-88444460 GAGAGGTTGTGGCCTAGGATTGG - Intergenic
979071011 4:116206352-116206374 CAGATGTTTTTGCAGAGGCAAGG + Intergenic
981243565 4:142507952-142507974 GACAGGTTTTTACAGATTATAGG + Intronic
982400775 4:154965474-154965496 AAGAGGGTTTTGCAGATAATAGG - Intergenic
985047344 4:185953418-185953440 GAGAGATTTTTCCAAAGGAAGGG - Intronic
985673947 5:1220730-1220752 AAGAGGGTTCAGCAGAGGATGGG + Intronic
988001498 5:25355272-25355294 GGGAAGTTTTTGCAGAGGTGAGG + Intergenic
990558542 5:56961095-56961117 GAGAGGTTCTTCCGAAGGATTGG - Intronic
991332305 5:65505030-65505052 GAGAGGCTAAGGCAGAGGATTGG - Intergenic
992001302 5:72438934-72438956 GTGAGGTTTCTGCTGAGGACAGG + Intergenic
992400923 5:76410589-76410611 CAGAGGGTTTTGCCGAGGATAGG + Intronic
992665275 5:79002264-79002286 AAGAGGTTTGTGGAGAGGTTTGG - Intronic
994331481 5:98511715-98511737 CAGAGATTTTTTCAGAGGTTGGG - Intergenic
994335381 5:98558944-98558966 AAGAGTTTTTTGCACAGGATAGG + Intergenic
995252754 5:110013293-110013315 GAGAGGATATGGCAGAGGAAGGG - Intergenic
995819453 5:116212398-116212420 TGGGGCTTTTTGCAGAGGATTGG + Intronic
996126751 5:119734602-119734624 GAGAGGCTTTTCCAGGGAATTGG - Intergenic
999130698 5:149281070-149281092 GAGTGCTTTGTGCAGAGGCTGGG + Intronic
999839842 5:155413193-155413215 GGGAGGTTTTTATAGAGCATTGG - Intergenic
1001485206 5:172115081-172115103 GAGATGGTTTTTCAGAGGAAGGG - Intronic
1003651980 6:7969146-7969168 GCTGGGATTTTGCAGAGGATGGG + Intronic
1004162312 6:13225475-13225497 GAGACCTTCTTGCATAGGATGGG - Intronic
1005380120 6:25225128-25225150 GAGAGGCTTTTGTTTAGGATGGG - Intergenic
1006796935 6:36737875-36737897 GAGAGGTAGAAGCAGAGGATAGG - Intergenic
1008555735 6:52671385-52671407 GAGGGGATTTTGCAGGGCATCGG + Intronic
1010022875 6:71181643-71181665 GAGATGTTGCTACAGAGGATGGG + Intergenic
1010480984 6:76353921-76353943 GAGAGGATTTTTCAGAGGAGAGG - Intergenic
1015036875 6:128666909-128666931 GAGAGGTAGTTGCTGAGGAAGGG + Intergenic
1015075774 6:129155259-129155281 GAAAGCTTTTTTCATAGGATAGG + Intronic
1015890855 6:137968371-137968393 GAGAAGTTTTTGGTGGGGATGGG + Intergenic
1018667654 6:166154229-166154251 GAGAGGTTTATGATGAGAATTGG - Intergenic
1018713506 6:166514410-166514432 GGGAGGTTTTCACAGAGGAGGGG + Intronic
1019882684 7:3876685-3876707 AAGATGTTTTTGGAGAGGAATGG + Intronic
1021791088 7:24206174-24206196 GAGCGGTTTTGGTGGAGGATTGG + Intergenic
1022298560 7:29080988-29081010 GGGAGGTTGTGGCAGTGGATGGG - Intronic
1023709345 7:42975278-42975300 GAGGGTTCTTTGAAGAGGATAGG + Intergenic
1027455956 7:78392384-78392406 GAGATACTTTTGCAGAGAATGGG + Intronic
1029299732 7:99570757-99570779 GAAAGGTTTTTGGAGATGAGGGG + Intronic
1032476707 7:132216153-132216175 AAGTGGTTTCTGCAGAGGATTGG + Intronic
1033207505 7:139435600-139435622 CAGAGGTTTGAGGAGAGGATTGG - Intergenic
1034488136 7:151379051-151379073 GAGAGGCCGTTGCAGAGGAGGGG + Intronic
1035305479 7:157928835-157928857 GAGAGGGCAGTGCAGAGGATAGG + Intronic
1036391504 8:8328124-8328146 GAAAGCTTTCTCCAGAGGATCGG + Exonic
1037900405 8:22684851-22684873 GAGAGGGTTCTCCAGAGGAAGGG - Intergenic
1038024855 8:23579126-23579148 GTGAGGCTTTTACAGAGGAGGGG + Intergenic
1038219065 8:25590351-25590373 GAGAGGTTTGAACAGATGATTGG - Intergenic
1038482480 8:27911151-27911173 GAGAGGTTTTTGCAAGGAGTGGG - Intronic
1041051910 8:53942492-53942514 GAGAAGTTTTTCCAGGGTATAGG - Intronic
1041127059 8:54652888-54652910 CAGAGGATTTTGCAAAGAATGGG - Intergenic
1041280196 8:56200697-56200719 GAATGGTTTTGGCAGAGGTTAGG - Intronic
1042278841 8:67033096-67033118 GAGAGGTTTATTCAGAAAATTGG + Intronic
1042423460 8:68619387-68619409 GAGAGGCTTTTGCAGATGAGAGG + Intronic
1042582089 8:70291199-70291221 GAGAGATTTATGCATAGGAGTGG - Intronic
1043376513 8:79655747-79655769 GAAAGGTTTTTTGAGGGGATAGG - Intronic
1043522157 8:81058058-81058080 GGGAACTTTTTGCAGAGGAAGGG + Intronic
1045834820 8:106507572-106507594 GAGAGGGTTGTGCAGGGAATCGG + Intronic
1047741358 8:127809550-127809572 GAGAGATTTGTCCAGAGGAAGGG + Intergenic
1048355045 8:133646378-133646400 AAGTGGTTTTTGGAGAAGATAGG + Intergenic
1048495408 8:134931361-134931383 GAAAGGTCTTTACTGAGGATGGG - Intergenic
1049988070 9:970625-970647 GACAGGTTTTTGCAGATGTTTGG + Intergenic
1051061904 9:13054597-13054619 GAGAGGTTTATTTAAAGGATTGG - Intergenic
1051694997 9:19758655-19758677 GAAAGGTTTTTGAACGGGATTGG + Intronic
1054815018 9:69466410-69466432 AAGAGGTGCTTGCAGAGGAGAGG - Intronic
1055207681 9:73751927-73751949 CAGAGGTCTGTGGAGAGGATAGG + Intergenic
1056254919 9:84789051-84789073 GAGAGGGTATTTCAGAGGAGTGG + Intronic
1056535485 9:87524131-87524153 TAGAGGTTCTTACAGAGGAGGGG + Intronic
1058147910 9:101431749-101431771 GAGTGCTTTTTGCATAGGTTGGG + Intronic
1058914393 9:109551675-109551697 GAGAGGTGGTTGCAGGTGATGGG - Intergenic
1059653097 9:116333766-116333788 GAGAGGTTTTTTCAGCAGAGTGG + Intronic
1062338144 9:136081564-136081586 GAGAGGCCTTTGCAGAGATTCGG - Intronic
1062422981 9:136492940-136492962 GAGAGGTTATTGCAGGGAATTGG + Intergenic
1186458612 X:9730539-9730561 GGGTGGGTTTTGCAGAGGAGTGG + Intronic
1186893674 X:13985079-13985101 GAGAGGTTGTTACAGAGGTGAGG - Intergenic
1190261466 X:48800395-48800417 GAGAGGTTTCTGAAGAGCAGGGG - Intergenic
1190597821 X:52064917-52064939 GACAGGGTTCTGCAGAGGACAGG + Intronic
1190611003 X:52189156-52189178 GACAGGGTTCTGCAGAGGACAGG - Intronic
1192104934 X:68306292-68306314 GAGAGCTTGATGCAGAGGCTTGG - Intronic
1199099429 X:143781491-143781513 GAGAGGTTGTTGGGCAGGATAGG + Intergenic
1199138077 X:144277275-144277297 GACATGTTTTTGCAGAGGTTAGG - Intergenic
1199340138 X:146668000-146668022 TAGAGGTTTCTGCAGATAATGGG - Intergenic
1199356853 X:146872590-146872612 CAGTAGGTTTTGCAGAGGATAGG - Intergenic
1200111082 X:153741204-153741226 AAGAGGTTTGTGCAGACGCTTGG + Intronic
1200692051 Y:6316154-6316176 AAGAGGTTTTTGTCCAGGATTGG + Intergenic
1201043221 Y:9858573-9858595 AAGAGGTTTTTGTCCAGGATTGG - Intergenic