ID: 946029492

View in Genome Browser
Species Human (GRCh38)
Location 2:216693423-216693445
Sequence GTTTAAGAGATTGGGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 449}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946029481_946029492 13 Left 946029481 2:216693387-216693409 CCCTCATGCACTTAATCCACACC 0: 1
1: 0
2: 1
3: 6
4: 111
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449
946029482_946029492 12 Left 946029482 2:216693388-216693410 CCTCATGCACTTAATCCACACCC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449
946029486_946029492 -9 Left 946029486 2:216693409-216693431 CCACTTGTGATCTGGTTTAAGAG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449
946029485_946029492 -8 Left 946029485 2:216693408-216693430 CCCACTTGTGATCTGGTTTAAGA 0: 1
1: 0
2: 1
3: 2
4: 119
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449
946029480_946029492 14 Left 946029480 2:216693386-216693408 CCCCTCATGCACTTAATCCACAC 0: 1
1: 0
2: 0
3: 14
4: 108
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449
946029479_946029492 20 Left 946029479 2:216693380-216693402 CCAGGGCCCCTCATGCACTTAAT 0: 1
1: 0
2: 0
3: 5
4: 86
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449
946029484_946029492 -3 Left 946029484 2:216693403-216693425 CCACACCCACTTGTGATCTGGTT 0: 1
1: 0
2: 2
3: 15
4: 251
Right 946029492 2:216693423-216693445 GTTTAAGAGATTGGGGAGGGCGG 0: 1
1: 0
2: 3
3: 40
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946029492 Original CRISPR GTTTAAGAGATTGGGGAGGG CGG Intronic