ID: 946031500

View in Genome Browser
Species Human (GRCh38)
Location 2:216708582-216708604
Sequence GCCCCACACCTCCCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946031500_946031504 19 Left 946031500 2:216708582-216708604 CCAGCTCCTGGGAGGTGTGGGGC No data
Right 946031504 2:216708624-216708646 TTTCAGCCTCACTGTTTAGCAGG No data
946031500_946031505 23 Left 946031500 2:216708582-216708604 CCAGCTCCTGGGAGGTGTGGGGC No data
Right 946031505 2:216708628-216708650 AGCCTCACTGTTTAGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946031500 Original CRISPR GCCCCACACCTCCCAGGAGC TGG (reversed) Intergenic
No off target data available for this crispr