ID: 946032363

View in Genome Browser
Species Human (GRCh38)
Location 2:216715396-216715418
Sequence CTGGGAAGAAGGAGCTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946032356_946032363 15 Left 946032356 2:216715358-216715380 CCGATAGATCTTCTTAATTAAAT No data
Right 946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG No data
946032355_946032363 27 Left 946032355 2:216715346-216715368 CCAGAAACTTGACCGATAGATCT No data
Right 946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG No data
946032354_946032363 30 Left 946032354 2:216715343-216715365 CCTCCAGAAACTTGACCGATAGA No data
Right 946032363 2:216715396-216715418 CTGGGAAGAAGGAGCTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946032363 Original CRISPR CTGGGAAGAAGGAGCTAGCT GGG Intergenic
No off target data available for this crispr