ID: 946035963

View in Genome Browser
Species Human (GRCh38)
Location 2:216742465-216742487
Sequence CCTAAATACCACTCTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946035963_946035968 9 Left 946035963 2:216742465-216742487 CCTGAAGGAGAGTGGTATTTAGG No data
Right 946035968 2:216742497-216742519 CTTAAAGAAGCAGGAACTTCAGG No data
946035963_946035969 10 Left 946035963 2:216742465-216742487 CCTGAAGGAGAGTGGTATTTAGG No data
Right 946035969 2:216742498-216742520 TTAAAGAAGCAGGAACTTCAGGG No data
946035963_946035965 0 Left 946035963 2:216742465-216742487 CCTGAAGGAGAGTGGTATTTAGG No data
Right 946035965 2:216742488-216742510 ACCCAGAGACTTAAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946035963 Original CRISPR CCTAAATACCACTCTCCTTC AGG (reversed) Intergenic
No off target data available for this crispr