ID: 946036269

View in Genome Browser
Species Human (GRCh38)
Location 2:216744858-216744880
Sequence CTTGAAGACCCCATAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946036263_946036269 16 Left 946036263 2:216744819-216744841 CCATGACAAGACTGTGTCAAAGT No data
Right 946036269 2:216744858-216744880 CTTGAAGACCCCATAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946036269 Original CRISPR CTTGAAGACCCCATAGAGCT GGG Intergenic
No off target data available for this crispr