ID: 946038758

View in Genome Browser
Species Human (GRCh38)
Location 2:216765972-216765994
Sequence ACCCCAGAGCCAGCCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946038758_946038761 -8 Left 946038758 2:216765972-216765994 CCACTCCTGGCTGGCTCTGGGGT No data
Right 946038761 2:216765987-216766009 TCTGGGGTTGGCTTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946038758 Original CRISPR ACCCCAGAGCCAGCCAGGAG TGG (reversed) Intergenic
No off target data available for this crispr