ID: 946039666

View in Genome Browser
Species Human (GRCh38)
Location 2:216772987-216773009
Sequence TCCATGTAATCCAACCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946039659_946039666 6 Left 946039659 2:216772958-216772980 CCCATAATCCTGGAGGAGCCTCC No data
Right 946039666 2:216772987-216773009 TCCATGTAATCCAACCTTCCTGG No data
946039661_946039666 -2 Left 946039661 2:216772966-216772988 CCTGGAGGAGCCTCCCACCATTC No data
Right 946039666 2:216772987-216773009 TCCATGTAATCCAACCTTCCTGG No data
946039660_946039666 5 Left 946039660 2:216772959-216772981 CCATAATCCTGGAGGAGCCTCCC No data
Right 946039666 2:216772987-216773009 TCCATGTAATCCAACCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946039666 Original CRISPR TCCATGTAATCCAACCTTCC TGG Intergenic
No off target data available for this crispr