ID: 946040290

View in Genome Browser
Species Human (GRCh38)
Location 2:216777071-216777093
Sequence TCCAGAAATATTATGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946040290_946040293 6 Left 946040290 2:216777071-216777093 CCTGTGCACATAATATTTCTGGA No data
Right 946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG No data
946040290_946040295 24 Left 946040290 2:216777071-216777093 CCTGTGCACATAATATTTCTGGA No data
Right 946040295 2:216777118-216777140 TCTGGAATAGAGTCTGGATTTGG No data
946040290_946040294 18 Left 946040290 2:216777071-216777093 CCTGTGCACATAATATTTCTGGA No data
Right 946040294 2:216777112-216777134 ATGGAGTCTGGAATAGAGTCTGG No data
946040290_946040292 -1 Left 946040290 2:216777071-216777093 CCTGTGCACATAATATTTCTGGA No data
Right 946040292 2:216777093-216777115 AAATACACAAAAGAACTGGATGG No data
946040290_946040291 -5 Left 946040290 2:216777071-216777093 CCTGTGCACATAATATTTCTGGA No data
Right 946040291 2:216777089-216777111 CTGGAAATACACAAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946040290 Original CRISPR TCCAGAAATATTATGTGCAC AGG (reversed) Intergenic
No off target data available for this crispr