ID: 946040293

View in Genome Browser
Species Human (GRCh38)
Location 2:216777100-216777122
Sequence CAAAAGAACTGGATGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946040290_946040293 6 Left 946040290 2:216777071-216777093 CCTGTGCACATAATATTTCTGGA No data
Right 946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946040293 Original CRISPR CAAAAGAACTGGATGGAGTC TGG Intergenic
No off target data available for this crispr