ID: 946042686

View in Genome Browser
Species Human (GRCh38)
Location 2:216795981-216796003
Sequence GAATCCCTACCCAAAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946042686_946042687 0 Left 946042686 2:216795981-216796003 CCTGGGGTTTTGGGTAGGGATTC No data
Right 946042687 2:216796004-216796026 TGTTTTGTTCGTTCCCAGTCTGG No data
946042686_946042692 22 Left 946042686 2:216795981-216796003 CCTGGGGTTTTGGGTAGGGATTC No data
Right 946042692 2:216796026-216796048 GAAGATGTGGCCAAGAGTGGAGG No data
946042686_946042688 9 Left 946042686 2:216795981-216796003 CCTGGGGTTTTGGGTAGGGATTC No data
Right 946042688 2:216796013-216796035 CGTTCCCAGTCTGGAAGATGTGG No data
946042686_946042691 19 Left 946042686 2:216795981-216796003 CCTGGGGTTTTGGGTAGGGATTC No data
Right 946042691 2:216796023-216796045 CTGGAAGATGTGGCCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946042686 Original CRISPR GAATCCCTACCCAAAACCCC AGG (reversed) Intergenic
No off target data available for this crispr