ID: 946046425 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:216824992-216825014 |
Sequence | AAGTGGTGATACAGGGAAGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946046418_946046425 | 2 | Left | 946046418 | 2:216824967-216824989 | CCTAATGAGCACGCCATTTTCCT | No data | ||
Right | 946046425 | 2:216824992-216825014 | AAGTGGTGATACAGGGAAGCAGG | No data | ||||
946046417_946046425 | 3 | Left | 946046417 | 2:216824966-216824988 | CCCTAATGAGCACGCCATTTTCC | No data | ||
Right | 946046425 | 2:216824992-216825014 | AAGTGGTGATACAGGGAAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946046425 | Original CRISPR | AAGTGGTGATACAGGGAAGC AGG | Intergenic | ||
No off target data available for this crispr |