ID: 946046425

View in Genome Browser
Species Human (GRCh38)
Location 2:216824992-216825014
Sequence AAGTGGTGATACAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946046418_946046425 2 Left 946046418 2:216824967-216824989 CCTAATGAGCACGCCATTTTCCT No data
Right 946046425 2:216824992-216825014 AAGTGGTGATACAGGGAAGCAGG No data
946046417_946046425 3 Left 946046417 2:216824966-216824988 CCCTAATGAGCACGCCATTTTCC No data
Right 946046425 2:216824992-216825014 AAGTGGTGATACAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946046425 Original CRISPR AAGTGGTGATACAGGGAAGC AGG Intergenic
No off target data available for this crispr