ID: 946053205

View in Genome Browser
Species Human (GRCh38)
Location 2:216880819-216880841
Sequence GTGGGGAAGCAGAAGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946053205_946053219 23 Left 946053205 2:216880819-216880841 CCCTCCCCCTTCTGCTTCCCCAC No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053205_946053222 27 Left 946053205 2:216880819-216880841 CCCTCCCCCTTCTGCTTCCCCAC No data
Right 946053222 2:216880869-216880891 ATTAGATTCCAGGAAATGGCTGG No data
946053205_946053218 17 Left 946053205 2:216880819-216880841 CCCTCCCCCTTCTGCTTCCCCAC No data
Right 946053218 2:216880859-216880881 ACTGGCTCCCATTAGATTCCAGG No data
946053205_946053215 -1 Left 946053205 2:216880819-216880841 CCCTCCCCCTTCTGCTTCCCCAC No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946053205 Original CRISPR GTGGGGAAGCAGAAGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr