ID: 946053215

View in Genome Browser
Species Human (GRCh38)
Location 2:216880841-216880863
Sequence CCCCTTCAAGTTCTCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946053206_946053215 -2 Left 946053206 2:216880820-216880842 CCTCCCCCTTCTGCTTCCCCACC No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053207_946053215 -5 Left 946053207 2:216880823-216880845 CCCCCTTCTGCTTCCCCACCCCT No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053203_946053215 19 Left 946053203 2:216880799-216880821 CCAGTCATCTGCCTTTTTTTCCC No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053208_946053215 -6 Left 946053208 2:216880824-216880846 CCCCTTCTGCTTCCCCACCCCTT No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053205_946053215 -1 Left 946053205 2:216880819-216880841 CCCTCCCCCTTCTGCTTCCCCAC No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053210_946053215 -8 Left 946053210 2:216880826-216880848 CCTTCTGCTTCCCCACCCCTTCA No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053209_946053215 -7 Left 946053209 2:216880825-216880847 CCCTTCTGCTTCCCCACCCCTTC No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053200_946053215 28 Left 946053200 2:216880790-216880812 CCCCACAAGCCAGTCATCTGCCT No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053204_946053215 8 Left 946053204 2:216880810-216880832 CCTTTTTTTCCCTCCCCCTTCTG No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053202_946053215 26 Left 946053202 2:216880792-216880814 CCACAAGCCAGTCATCTGCCTTT No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
946053201_946053215 27 Left 946053201 2:216880791-216880813 CCCACAAGCCAGTCATCTGCCTT No data
Right 946053215 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946053215 Original CRISPR CCCCTTCAAGTTCTCAGAAC TGG Intergenic
No off target data available for this crispr