ID: 946053219

View in Genome Browser
Species Human (GRCh38)
Location 2:216880865-216880887
Sequence TCCCATTAGATTCCAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946053209_946053219 17 Left 946053209 2:216880825-216880847 CCCTTCTGCTTCCCCACCCCTTC No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053205_946053219 23 Left 946053205 2:216880819-216880841 CCCTCCCCCTTCTGCTTCCCCAC No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053210_946053219 16 Left 946053210 2:216880826-216880848 CCTTCTGCTTCCCCACCCCTTCA No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053214_946053219 1 Left 946053214 2:216880841-216880863 CCCCTTCAAGTTCTCAGAACTGG No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053217_946053219 -1 Left 946053217 2:216880843-216880865 CCTTCAAGTTCTCAGAACTGGCT No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053216_946053219 0 Left 946053216 2:216880842-216880864 CCCTTCAAGTTCTCAGAACTGGC No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053208_946053219 18 Left 946053208 2:216880824-216880846 CCCCTTCTGCTTCCCCACCCCTT No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053212_946053219 5 Left 946053212 2:216880837-216880859 CCCACCCCTTCAAGTTCTCAGAA No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053207_946053219 19 Left 946053207 2:216880823-216880845 CCCCCTTCTGCTTCCCCACCCCT No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053211_946053219 6 Left 946053211 2:216880836-216880858 CCCCACCCCTTCAAGTTCTCAGA No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053213_946053219 4 Left 946053213 2:216880838-216880860 CCACCCCTTCAAGTTCTCAGAAC No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data
946053206_946053219 22 Left 946053206 2:216880820-216880842 CCTCCCCCTTCTGCTTCCCCACC No data
Right 946053219 2:216880865-216880887 TCCCATTAGATTCCAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946053219 Original CRISPR TCCCATTAGATTCCAGGAAA TGG Intergenic
No off target data available for this crispr