ID: 946054763

View in Genome Browser
Species Human (GRCh38)
Location 2:216891085-216891107
Sequence GGGTCCTGCTTTGGCACCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054763_946054766 -10 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054766 2:216891098-216891120 AGCAGGACCCACCAGGAAACTGG No data
946054763_946054767 -9 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054767 2:216891099-216891121 GCAGGACCCACCAGGAAACTGGG No data
946054763_946054772 22 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data
946054763_946054773 23 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054763 Original CRISPR GGGTCCTGCTTTGGCACCTT AGG (reversed) Intergenic