ID: 946054766

View in Genome Browser
Species Human (GRCh38)
Location 2:216891098-216891120
Sequence AGCAGGACCCACCAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054763_946054766 -10 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054766 2:216891098-216891120 AGCAGGACCCACCAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054766 Original CRISPR AGCAGGACCCACCAGGAAAC TGG Intergenic