ID: 946054767

View in Genome Browser
Species Human (GRCh38)
Location 2:216891099-216891121
Sequence GCAGGACCCACCAGGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054763_946054767 -9 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054767 2:216891099-216891121 GCAGGACCCACCAGGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054767 Original CRISPR GCAGGACCCACCAGGAAACT GGG Intergenic