ID: 946054768

View in Genome Browser
Species Human (GRCh38)
Location 2:216891105-216891127
Sequence GCTTTGCCCAGTTTCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054768_946054776 23 Left 946054768 2:216891105-216891127 CCCACCAGGAAACTGGGCAAAGC No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054768_946054773 3 Left 946054768 2:216891105-216891127 CCCACCAGGAAACTGGGCAAAGC No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054768_946054772 2 Left 946054768 2:216891105-216891127 CCCACCAGGAAACTGGGCAAAGC No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054768 Original CRISPR GCTTTGCCCAGTTTCCTGGT GGG (reversed) Intergenic