ID: 946054769

View in Genome Browser
Species Human (GRCh38)
Location 2:216891106-216891128
Sequence GGCTTTGCCCAGTTTCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054769_946054773 2 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054769_946054776 22 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054769_946054777 30 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data
946054769_946054772 1 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054769 Original CRISPR GGCTTTGCCCAGTTTCCTGG TGG (reversed) Intergenic