ID: 946054770

View in Genome Browser
Species Human (GRCh38)
Location 2:216891109-216891131
Sequence CAAGGCTTTGCCCAGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054770_946054772 -2 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data
946054770_946054773 -1 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054770_946054776 19 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054770_946054777 27 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054770 Original CRISPR CAAGGCTTTGCCCAGTTTCC TGG (reversed) Intergenic