ID: 946054772

View in Genome Browser
Species Human (GRCh38)
Location 2:216891130-216891152
Sequence TGAACCCAGTAAAAGATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054769_946054772 1 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data
946054768_946054772 2 Left 946054768 2:216891105-216891127 CCCACCAGGAAACTGGGCAAAGC No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data
946054765_946054772 13 Left 946054765 2:216891094-216891116 CCAAAGCAGGACCCACCAGGAAA No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data
946054770_946054772 -2 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data
946054763_946054772 22 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054772 2:216891130-216891152 TGAACCCAGTAAAAGATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054772 Original CRISPR TGAACCCAGTAAAAGATAAA TGG Intergenic