ID: 946054773

View in Genome Browser
Species Human (GRCh38)
Location 2:216891131-216891153
Sequence GAACCCAGTAAAAGATAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054768_946054773 3 Left 946054768 2:216891105-216891127 CCCACCAGGAAACTGGGCAAAGC No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054769_946054773 2 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054765_946054773 14 Left 946054765 2:216891094-216891116 CCAAAGCAGGACCCACCAGGAAA No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054770_946054773 -1 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data
946054763_946054773 23 Left 946054763 2:216891085-216891107 CCTAAGGTGCCAAAGCAGGACCC No data
Right 946054773 2:216891131-216891153 GAACCCAGTAAAAGATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054773 Original CRISPR GAACCCAGTAAAAGATAAAT GGG Intergenic