ID: 946054776

View in Genome Browser
Species Human (GRCh38)
Location 2:216891151-216891173
Sequence GGGAGATGAAAAATGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054771_946054776 1 Left 946054771 2:216891127-216891149 CCTTGAACCCAGTAAAAGATAAA No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054768_946054776 23 Left 946054768 2:216891105-216891127 CCCACCAGGAAACTGGGCAAAGC No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054774_946054776 -6 Left 946054774 2:216891134-216891156 CCCAGTAAAAGATAAATGGGAGA No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054769_946054776 22 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054775_946054776 -7 Left 946054775 2:216891135-216891157 CCAGTAAAAGATAAATGGGAGAT No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data
946054770_946054776 19 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054776 2:216891151-216891173 GGGAGATGAAAAATGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054776 Original CRISPR GGGAGATGAAAAATGTTAGA AGG Intergenic