ID: 946054777

View in Genome Browser
Species Human (GRCh38)
Location 2:216891159-216891181
Sequence AAAAATGTTAGAAGGAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946054769_946054777 30 Left 946054769 2:216891106-216891128 CCACCAGGAAACTGGGCAAAGCC No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data
946054770_946054777 27 Left 946054770 2:216891109-216891131 CCAGGAAACTGGGCAAAGCCTTG No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data
946054774_946054777 2 Left 946054774 2:216891134-216891156 CCCAGTAAAAGATAAATGGGAGA No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data
946054775_946054777 1 Left 946054775 2:216891135-216891157 CCAGTAAAAGATAAATGGGAGAT No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data
946054771_946054777 9 Left 946054771 2:216891127-216891149 CCTTGAACCCAGTAAAAGATAAA No data
Right 946054777 2:216891159-216891181 AAAAATGTTAGAAGGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946054777 Original CRISPR AAAAATGTTAGAAGGAGTCA AGG Intergenic