ID: 946058002

View in Genome Browser
Species Human (GRCh38)
Location 2:216918261-216918283
Sequence CACTTCCCATCTCAGATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946057999_946058002 -3 Left 946057999 2:216918241-216918263 CCGGTGATTCATGCCGTCATCAC No data
Right 946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG No data
946057993_946058002 27 Left 946057993 2:216918211-216918233 CCTTGGTCATCTTCTCCTCTCTC No data
Right 946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG No data
946057995_946058002 12 Left 946057995 2:216918226-216918248 CCTCTCTCTCCTTCCCCGGTGAT No data
Right 946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG No data
946057998_946058002 -2 Left 946057998 2:216918240-216918262 CCCGGTGATTCATGCCGTCATCA No data
Right 946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG No data
946057996_946058002 3 Left 946057996 2:216918235-216918257 CCTTCCCCGGTGATTCATGCCGT No data
Right 946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG No data
946057997_946058002 -1 Left 946057997 2:216918239-216918261 CCCCGGTGATTCATGCCGTCATC No data
Right 946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946058002 Original CRISPR CACTTCCCATCTCAGATCCT GGG Intergenic
No off target data available for this crispr