ID: 946060289

View in Genome Browser
Species Human (GRCh38)
Location 2:216935307-216935329
Sequence CTACTTTTCCAGGACTCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946060287_946060289 -6 Left 946060287 2:216935290-216935312 CCAAAGATAAGCTGCTTCTACTT No data
Right 946060289 2:216935307-216935329 CTACTTTTCCAGGACTCCTCCGG No data
946060286_946060289 -5 Left 946060286 2:216935289-216935311 CCCAAAGATAAGCTGCTTCTACT No data
Right 946060289 2:216935307-216935329 CTACTTTTCCAGGACTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946060289 Original CRISPR CTACTTTTCCAGGACTCCTC CGG Intergenic
No off target data available for this crispr