ID: 946067835

View in Genome Browser
Species Human (GRCh38)
Location 2:217004722-217004744
Sequence ACATATCCACAGAGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946067835_946067842 28 Left 946067835 2:217004722-217004744 CCAGCCACTCTCTGTGGATATGT No data
Right 946067842 2:217004773-217004795 AGCCAACCATAACTTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946067835 Original CRISPR ACATATCCACAGAGAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr