ID: 946072788

View in Genome Browser
Species Human (GRCh38)
Location 2:217048749-217048771
Sequence TGGATGCTCTGGCTTCCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946072781_946072788 19 Left 946072781 2:217048707-217048729 CCTCAGGGGCTGCCCATTTTCAG No data
Right 946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG No data
946072784_946072788 6 Left 946072784 2:217048720-217048742 CCATTTTCAGGTTGCATTTATTA No data
Right 946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG No data
946072783_946072788 7 Left 946072783 2:217048719-217048741 CCCATTTTCAGGTTGCATTTATT No data
Right 946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946072788 Original CRISPR TGGATGCTCTGGCTTCCAGT AGG Intergenic
No off target data available for this crispr