ID: 946073401

View in Genome Browser
Species Human (GRCh38)
Location 2:217053624-217053646
Sequence CTTCTCTTCTAGGGCCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946073401_946073407 1 Left 946073401 2:217053624-217053646 CCATACAGGCCCTAGAAGAGAAG No data
Right 946073407 2:217053648-217053670 GAGGACGCGGGTGACCCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946073401 Original CRISPR CTTCTCTTCTAGGGCCTGTA TGG (reversed) Intergenic
No off target data available for this crispr