ID: 946073556

View in Genome Browser
Species Human (GRCh38)
Location 2:217054765-217054787
Sequence CATTAACCCCTAGTGGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946073556_946073559 -4 Left 946073556 2:217054765-217054787 CCAAGATCCACTAGGGGTTAATG No data
Right 946073559 2:217054784-217054806 AATGCCACTGATCTGATACTGGG No data
946073556_946073558 -5 Left 946073556 2:217054765-217054787 CCAAGATCCACTAGGGGTTAATG No data
Right 946073558 2:217054783-217054805 TAATGCCACTGATCTGATACTGG No data
946073556_946073563 11 Left 946073556 2:217054765-217054787 CCAAGATCCACTAGGGGTTAATG No data
Right 946073563 2:217054799-217054821 ATACTGGGGCACAGCCTAGGAGG No data
946073556_946073562 8 Left 946073556 2:217054765-217054787 CCAAGATCCACTAGGGGTTAATG No data
Right 946073562 2:217054796-217054818 CTGATACTGGGGCACAGCCTAGG No data
946073556_946073560 -3 Left 946073556 2:217054765-217054787 CCAAGATCCACTAGGGGTTAATG No data
Right 946073560 2:217054785-217054807 ATGCCACTGATCTGATACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946073556 Original CRISPR CATTAACCCCTAGTGGATCT TGG (reversed) Intergenic
No off target data available for this crispr