ID: 946076128

View in Genome Browser
Species Human (GRCh38)
Location 2:217075181-217075203
Sequence CAGGGTAGAGAAAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946076128_946076134 12 Left 946076128 2:217075181-217075203 CCTTCCTGCTTTTCTCTACCCTG No data
Right 946076134 2:217075216-217075238 GTCCAACCAGCCTTCCTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946076128 Original CRISPR CAGGGTAGAGAAAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr