ID: 946083789 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:217150723-217150745 |
Sequence | CTTTCTATGGAGCGGTAGGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946083778_946083789 | 25 | Left | 946083778 | 2:217150675-217150697 | CCCAGGTGTGGAAGAAGGAAAGG | No data | ||
Right | 946083789 | 2:217150723-217150745 | CTTTCTATGGAGCGGTAGGCTGG | No data | ||||
946083780_946083789 | 24 | Left | 946083780 | 2:217150676-217150698 | CCAGGTGTGGAAGAAGGAAAGGG | No data | ||
Right | 946083789 | 2:217150723-217150745 | CTTTCTATGGAGCGGTAGGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946083789 | Original CRISPR | CTTTCTATGGAGCGGTAGGC TGG | Intergenic | ||
No off target data available for this crispr |