ID: 946083789

View in Genome Browser
Species Human (GRCh38)
Location 2:217150723-217150745
Sequence CTTTCTATGGAGCGGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946083778_946083789 25 Left 946083778 2:217150675-217150697 CCCAGGTGTGGAAGAAGGAAAGG No data
Right 946083789 2:217150723-217150745 CTTTCTATGGAGCGGTAGGCTGG No data
946083780_946083789 24 Left 946083780 2:217150676-217150698 CCAGGTGTGGAAGAAGGAAAGGG No data
Right 946083789 2:217150723-217150745 CTTTCTATGGAGCGGTAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946083789 Original CRISPR CTTTCTATGGAGCGGTAGGC TGG Intergenic
No off target data available for this crispr