ID: 946085923

View in Genome Browser
Species Human (GRCh38)
Location 2:217171447-217171469
Sequence GTGGGGAGGAGCCCAGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085923_946085938 24 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085923_946085931 3 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085923_946085937 23 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085937 2:217171493-217171515 TGGTCACTGGGAGAGAAAAATGG No data
946085923_946085934 10 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085934 2:217171480-217171502 AACCAGATGTGTGTGGTCACTGG No data
946085923_946085935 11 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085923 Original CRISPR GTGGGGAGGAGCCCAGGTGG TGG (reversed) Intergenic
No off target data available for this crispr