ID: 946085924

View in Genome Browser
Species Human (GRCh38)
Location 2:217171450-217171472
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085924_946085938 21 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085924_946085934 7 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085934 2:217171480-217171502 AACCAGATGTGTGTGGTCACTGG No data
946085924_946085935 8 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085924_946085931 0 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085924_946085939 28 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085924_946085937 20 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085937 2:217171493-217171515 TGGTCACTGGGAGAGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085924 Original CRISPR GGAGTGGGGAGGAGCCCAGG TGG (reversed) Intergenic
No off target data available for this crispr