ID: 946085925

View in Genome Browser
Species Human (GRCh38)
Location 2:217171453-217171475
Sequence GGAGGAGTGGGGAGGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085925_946085934 4 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085934 2:217171480-217171502 AACCAGATGTGTGTGGTCACTGG No data
946085925_946085939 25 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085925_946085931 -3 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085925_946085937 17 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085937 2:217171493-217171515 TGGTCACTGGGAGAGAAAAATGG No data
946085925_946085935 5 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085925_946085938 18 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085925 Original CRISPR GGAGGAGTGGGGAGGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr