ID: 946085928

View in Genome Browser
Species Human (GRCh38)
Location 2:217171465-217171487
Sequence ATCTGGTTGGAAGGAGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085928_946085935 -7 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085928_946085939 13 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085928_946085940 27 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085940 2:217171515-217171537 GGTTCCTGGATCAAGCTTTGAGG No data
946085928_946085934 -8 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085934 2:217171480-217171502 AACCAGATGTGTGTGGTCACTGG No data
946085928_946085937 5 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085937 2:217171493-217171515 TGGTCACTGGGAGAGAAAAATGG No data
946085928_946085938 6 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085928_946085941 28 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085941 2:217171516-217171538 GTTCCTGGATCAAGCTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085928 Original CRISPR ATCTGGTTGGAAGGAGGAGT GGG (reversed) Intergenic
No off target data available for this crispr