ID: 946085931

View in Genome Browser
Species Human (GRCh38)
Location 2:217171473-217171495
Sequence TCCTTCCAACCAGATGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085921_946085931 5 Left 946085921 2:217171445-217171467 CCCCACCACCTGGGCTCCTCCCC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085923_946085931 3 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085924_946085931 0 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085922_946085931 4 Left 946085922 2:217171446-217171468 CCCACCACCTGGGCTCCTCCCCA No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data
946085925_946085931 -3 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085931 2:217171473-217171495 TCCTTCCAACCAGATGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085931 Original CRISPR TCCTTCCAACCAGATGTGTG TGG Intergenic
No off target data available for this crispr