ID: 946085935

View in Genome Browser
Species Human (GRCh38)
Location 2:217171481-217171503
Sequence ACCAGATGTGTGTGGTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085924_946085935 8 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085922_946085935 12 Left 946085922 2:217171446-217171468 CCCACCACCTGGGCTCCTCCCCA No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085929_946085935 -8 Left 946085929 2:217171466-217171488 CCACTCCTCCTTCCAACCAGATG No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085921_946085935 13 Left 946085921 2:217171445-217171467 CCCCACCACCTGGGCTCCTCCCC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085926_946085935 -3 Left 946085926 2:217171461-217171483 CCTCCCCACTCCTCCTTCCAACC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085923_946085935 11 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085927_946085935 -6 Left 946085927 2:217171464-217171486 CCCCACTCCTCCTTCCAACCAGA No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085925_946085935 5 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data
946085928_946085935 -7 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085935 2:217171481-217171503 ACCAGATGTGTGTGGTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085935 Original CRISPR ACCAGATGTGTGTGGTCACT GGG Intergenic
No off target data available for this crispr