ID: 946085938

View in Genome Browser
Species Human (GRCh38)
Location 2:217171494-217171516
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085932_946085938 -3 Left 946085932 2:217171474-217171496 CCTTCCAACCAGATGTGTGTGGT No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085930_946085938 0 Left 946085930 2:217171471-217171493 CCTCCTTCCAACCAGATGTGTGT No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085927_946085938 7 Left 946085927 2:217171464-217171486 CCCCACTCCTCCTTCCAACCAGA No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085925_946085938 18 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085922_946085938 25 Left 946085922 2:217171446-217171468 CCCACCACCTGGGCTCCTCCCCA No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085924_946085938 21 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085923_946085938 24 Left 946085923 2:217171447-217171469 CCACCACCTGGGCTCCTCCCCAC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085933_946085938 -7 Left 946085933 2:217171478-217171500 CCAACCAGATGTGTGTGGTCACT No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085921_946085938 26 Left 946085921 2:217171445-217171467 CCCCACCACCTGGGCTCCTCCCC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085929_946085938 5 Left 946085929 2:217171466-217171488 CCACTCCTCCTTCCAACCAGATG No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085928_946085938 6 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data
946085926_946085938 10 Left 946085926 2:217171461-217171483 CCTCCCCACTCCTCCTTCCAACC No data
Right 946085938 2:217171494-217171516 GGTCACTGGGAGAGAAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr