ID: 946085939

View in Genome Browser
Species Human (GRCh38)
Location 2:217171501-217171523
Sequence GGGAGAGAAAAATGGGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946085930_946085939 7 Left 946085930 2:217171471-217171493 CCTCCTTCCAACCAGATGTGTGT No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085926_946085939 17 Left 946085926 2:217171461-217171483 CCTCCCCACTCCTCCTTCCAACC No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085933_946085939 0 Left 946085933 2:217171478-217171500 CCAACCAGATGTGTGTGGTCACT No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085927_946085939 14 Left 946085927 2:217171464-217171486 CCCCACTCCTCCTTCCAACCAGA No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085924_946085939 28 Left 946085924 2:217171450-217171472 CCACCTGGGCTCCTCCCCACTCC No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085928_946085939 13 Left 946085928 2:217171465-217171487 CCCACTCCTCCTTCCAACCAGAT No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085925_946085939 25 Left 946085925 2:217171453-217171475 CCTGGGCTCCTCCCCACTCCTCC No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085936_946085939 -4 Left 946085936 2:217171482-217171504 CCAGATGTGTGTGGTCACTGGGA No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085929_946085939 12 Left 946085929 2:217171466-217171488 CCACTCCTCCTTCCAACCAGATG No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data
946085932_946085939 4 Left 946085932 2:217171474-217171496 CCTTCCAACCAGATGTGTGTGGT No data
Right 946085939 2:217171501-217171523 GGGAGAGAAAAATGGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946085939 Original CRISPR GGGAGAGAAAAATGGGTTCC TGG Intergenic
No off target data available for this crispr