ID: 946093639

View in Genome Browser
Species Human (GRCh38)
Location 2:217252786-217252808
Sequence AAGACTAGGAAGGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946093639_946093646 19 Left 946093639 2:217252786-217252808 CCAGCAGCTTCCTTCCTAGTCTT No data
Right 946093646 2:217252828-217252850 GCCTTTCTTACCAATGTGGCTGG No data
946093639_946093645 15 Left 946093639 2:217252786-217252808 CCAGCAGCTTCCTTCCTAGTCTT No data
Right 946093645 2:217252824-217252846 TTCTGCCTTTCTTACCAATGTGG No data
946093639_946093648 22 Left 946093639 2:217252786-217252808 CCAGCAGCTTCCTTCCTAGTCTT No data
Right 946093648 2:217252831-217252853 TTTCTTACCAATGTGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946093639 Original CRISPR AAGACTAGGAAGGAAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr