ID: 946097059

View in Genome Browser
Species Human (GRCh38)
Location 2:217283693-217283715
Sequence TCATTCCCACGCACTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946097051_946097059 18 Left 946097051 2:217283652-217283674 CCTGCAAAGCCTTAGGAAGGCCT No data
Right 946097059 2:217283693-217283715 TCATTCCCACGCACTCCTGATGG No data
946097058_946097059 -2 Left 946097058 2:217283672-217283694 CCTCATGGGGGGAGCTTGAACTC No data
Right 946097059 2:217283693-217283715 TCATTCCCACGCACTCCTGATGG No data
946097049_946097059 21 Left 946097049 2:217283649-217283671 CCTCCTGCAAAGCCTTAGGAAGG No data
Right 946097059 2:217283693-217283715 TCATTCCCACGCACTCCTGATGG No data
946097056_946097059 9 Left 946097056 2:217283661-217283683 CCTTAGGAAGGCCTCATGGGGGG No data
Right 946097059 2:217283693-217283715 TCATTCCCACGCACTCCTGATGG No data
946097048_946097059 22 Left 946097048 2:217283648-217283670 CCCTCCTGCAAAGCCTTAGGAAG No data
Right 946097059 2:217283693-217283715 TCATTCCCACGCACTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946097059 Original CRISPR TCATTCCCACGCACTCCTGA TGG Intergenic