ID: 946097274

View in Genome Browser
Species Human (GRCh38)
Location 2:217286151-217286173
Sequence GACCTAAATTTGGCATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946097274_946097280 29 Left 946097274 2:217286151-217286173 CCATAGGATGCCAAATTTAGGTC 0: 1
1: 0
2: 1
3: 3
4: 78
Right 946097280 2:217286203-217286225 ATAAGACAAACTATTCAATTTGG 0: 1
1: 0
2: 3
3: 29
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946097274 Original CRISPR GACCTAAATTTGGCATCCTA TGG (reversed) Intronic
907745031 1:57204554-57204576 GACTTAGATTTGGCATCATCTGG + Intronic
910629649 1:89341864-89341886 GAACTAAATTTGGTAGCCAAAGG + Intergenic
912939645 1:114033544-114033566 GACCTTCCATTGGCATCCTACGG + Intergenic
916631646 1:166621082-166621104 GAGCTATATTTGGCATCTTCAGG + Intergenic
918158612 1:181875331-181875353 GAGCAAAAATTGGCATTCTAAGG + Intergenic
1063288203 10:4712771-4712793 GCCTTAAATTTGTCTTCCTAAGG - Intergenic
1064386780 10:14901379-14901401 GCACTAAGTTTGTCATCCTAAGG + Intronic
1064709090 10:18104866-18104888 ACCATAAATTTGGCATCATAAGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068725459 10:60296258-60296280 GACCTTAAGTGGACATCCTATGG - Intronic
1074550251 10:114436188-114436210 GGCCTCAATATGACATCCTATGG + Exonic
1074805352 10:117044844-117044866 GTCCTAATTTTGGCATATTAAGG + Intronic
1084142381 11:67241202-67241224 GACCTGAATTTTTCACCCTAGGG + Intronic
1085882653 11:80486056-80486078 GACCTAAGATTGGAATCCTGGGG + Intergenic
1089036404 11:115397955-115397977 GCCATACTTTTGGCATCCTATGG + Intronic
1091474120 12:754354-754376 GAGCCAAATTTGGGATCCAAAGG - Intronic
1098824315 12:75274210-75274232 GACCTGCATATGTCATCCTAGGG - Intergenic
1099754165 12:86820883-86820905 GAACTACATTTGACATGCTATGG - Intronic
1101200668 12:102432676-102432698 GACTTGAGTTTGGCATCCAAAGG + Intronic
1101988273 12:109464135-109464157 GACCTCTCTTTGCCATCCTAAGG + Intronic
1102381783 12:112473353-112473375 GACACAAATCTGGCACCCTAAGG - Intronic
1129949393 15:79572609-79572631 GACCTATACTTGGCCTCCCATGG + Intergenic
1131388653 15:92029254-92029276 ATCCTAAATTTGGCAACCTCAGG - Intronic
1133298696 16:4768546-4768568 ATCCTAACTTGGGCATCCTAAGG + Intergenic
1136124071 16:28163807-28163829 CACCTAGATTTGGAATTCTAGGG + Intronic
1136646157 16:31618096-31618118 GATCTAAATTTGGCCTTCCATGG - Intergenic
1152303234 17:79507386-79507408 GGCCTAAATTTGGCGTCCATGGG + Intronic
1155976094 18:32133424-32133446 TACCTACATTTGGCATCCCCAGG - Intronic
1159253728 18:65917389-65917411 GTCCTAAATTTGATATCATACGG - Intergenic
1165658066 19:37550779-37550801 CACCTAAAACTGGCATCCCATGG - Intergenic
1165737000 19:38183247-38183269 GATCTAAATTGGGCATTCCAGGG + Intronic
1166585730 19:43946747-43946769 GATCTCAATTTGACAGCCTAAGG - Intergenic
927091286 2:19714738-19714760 GACCTCAATTTGATTTCCTAAGG - Intergenic
930025357 2:47026096-47026118 GACCTCATTTTGGCAGCCTCAGG + Intronic
935690702 2:105729356-105729378 GAACTAAATTTGGCAATGTAAGG - Intergenic
942745108 2:179222780-179222802 GACACAGATTTGCCATCCTAAGG + Intronic
946097274 2:217286151-217286173 GACCTAAATTTGGCATCCTATGG - Intronic
1176427680 21:6558839-6558861 CACCTTAATTTGGCACCCCAGGG + Intergenic
1178140347 21:29675841-29675863 GCCCTAAATTTGGTATCAGAAGG - Intronic
1179703172 21:43167156-43167178 CACCTTAATTTGGCACCCCAGGG + Intergenic
1181154152 22:20907702-20907724 GACCTAAAGTTGGCAAACAATGG + Intergenic
1183545385 22:38452634-38452656 GAGCCAAATTTGGCATCCTAGGG + Intronic
1184419874 22:44373604-44373626 GATCTAAATTCTGCATCCAAAGG + Intergenic
964821013 3:160769441-160769463 GACATAAATTTGGTATTTTAGGG + Intronic
967367516 3:188704441-188704463 GACCTTCACTTGGCATCCTTAGG - Intronic
967440582 3:189503161-189503183 GACTTAAATGTGGCATACTTGGG + Intergenic
972047218 4:34681565-34681587 GACCTAAATTTTTCAACATATGG - Intergenic
972074550 4:35069526-35069548 GACCTAAATTTGGAAAACTATGG + Intergenic
980226225 4:129989831-129989853 GAACTAAATTTGTCATACTTTGG - Intergenic
995921494 5:117319440-117319462 AACCTCAATGTGGCATCCTGAGG - Intergenic
996715279 5:126582442-126582464 GACCTAAATGTCGAATCATAAGG - Intronic
996812263 5:127529921-127529943 GACCTTTATTTGGGACCCTAAGG + Intronic
999250546 5:150179881-150179903 GCCCTAAATTTGGCAGCATGCGG + Intronic
999782330 5:154859296-154859318 GACCTGAATTTGGAATCTTGCGG + Intronic
1000807068 5:165808994-165809016 CACATATATTTGCCATCCTATGG - Intergenic
1002023711 5:176382874-176382896 GGCCTGAATTTGGAATCCTGTGG + Intronic
1003811957 6:9794035-9794057 GTGTTAAATTTGGCATCCTTTGG - Intronic
1010113933 6:72277644-72277666 TACATAAATTTGGAATCCCAGGG + Intronic
1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG + Intergenic
1012812371 6:103976323-103976345 AACCTAAATTTGGAAGCTTAAGG + Intergenic
1013122513 6:107153412-107153434 GACCAAAATTTGACATTCTGAGG + Exonic
1013744014 6:113323068-113323090 CACCTAAATTTTGGATCCTTGGG + Intergenic
1014389954 6:120849576-120849598 CACTTAAATTTGGCCTTCTAAGG + Intergenic
1015160372 6:130146612-130146634 TACCTAAATTTAGGATACTATGG - Intronic
1021297835 7:18930866-18930888 CATCTAAATTTGGCATTTTATGG + Intronic
1021627119 7:22604173-22604195 TACCTAACATTGGAATCCTATGG - Intronic
1022303128 7:29120494-29120516 GAAATATATTTTGCATCCTATGG + Intronic
1023320611 7:38993873-38993895 GAGCTAAATTTTGCCTCCAAAGG - Intronic
1033119664 7:138656405-138656427 TACCTGCCTTTGGCATCCTATGG - Intronic
1034074503 7:148218768-148218790 CACCTAAAATTGGCATCCTGAGG + Intronic
1036174756 8:6526599-6526621 GACTTAAACTTGGTATCCAAAGG + Intronic
1036607869 8:10323585-10323607 TACCTAAATTTTACCTCCTATGG - Intronic
1039106032 8:33990671-33990693 GAAGTAAATTTGGCATCTTTAGG + Intergenic
1041181204 8:55250454-55250476 GCCCTAAATTAGACATCCAAAGG - Intronic
1046028441 8:108753496-108753518 CACCTAAAGTTGCCATCCAAAGG - Intronic
1046261985 8:111780609-111780631 AACCAAACGTTGGCATCCTATGG + Intergenic
1047301324 8:123615919-123615941 GCCCAAAACTTGGTATCCTAGGG - Intergenic
1048901488 8:139042078-139042100 GACATACATGAGGCATCCTAGGG - Intergenic
1053093474 9:35302390-35302412 GAACTAAGTTTGGCATCTTCAGG - Intronic
1055758066 9:79575823-79575845 GATGAAAATTTGGTATCCTACGG - Intronic
1059328410 9:113518880-113518902 GACCTAAGTCTGGCATCCAAGGG + Intronic
1193568666 X:83113532-83113554 GCCCTGAATTTTGAATCCTAAGG + Intergenic
1198390790 X:136171771-136171793 GACCAAAACTTGGTATCCTTGGG + Intronic