ID: 946097714

View in Genome Browser
Species Human (GRCh38)
Location 2:217290073-217290095
Sequence TTGCCTTTCAAGAAGATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946097714 Original CRISPR TTGCCTTTCAAGAAGATTAA TGG (reversed) Intronic
901348504 1:8569237-8569259 TTGCTTTTAAAGAAATTTAATGG - Intronic
901538990 1:9902547-9902569 TTGGCTTTCCAGAAGAGCAAGGG - Intronic
905420560 1:37840732-37840754 TCCCCTTTCAAGAAGTTTGATGG - Intronic
905726505 1:40256984-40257006 TTTGCTTTCAACAAAATTAATGG - Intergenic
905904743 1:41610507-41610529 ATGCCTTTCAAGAGGCTCAATGG - Intronic
906007125 1:42484392-42484414 TTGCCATACAAGAAGAAAAAAGG + Intronic
908206114 1:61851564-61851586 TTTCCTTCCACGAAGAATAAAGG + Intronic
908588090 1:65596331-65596353 TTGCCTTTCAAGTACTTAAAAGG - Intronic
908668448 1:66518818-66518840 TAGACATTAAAGAAGATTAAAGG + Intergenic
908777298 1:67652929-67652951 TTGCAATTCAAGAAGGGTAAGGG - Intergenic
909451291 1:75800426-75800448 TTGCTTTTCAGAAAGATTATTGG + Intronic
910329290 1:86051393-86051415 TTGCCTAGAGAGAAGATTAATGG + Intronic
910359485 1:86401033-86401055 ATGGCTTACAAGAAGGTTAAGGG - Intergenic
910405599 1:86886793-86886815 TTGCCTTTAAATAAAATGAAGGG + Intronic
912951996 1:114126682-114126704 TTCCCTTACAAGAGGATGAATGG - Intronic
912982671 1:114390752-114390774 TTGCCTTTCCAGATCACTAACGG + Intergenic
913614175 1:120540425-120540447 TTTCAACTCAAGAAGATTAATGG - Intergenic
914328000 1:146639635-146639657 TTGCTTGTCAAGAAGCCTAAAGG - Intergenic
914576091 1:148970473-148970495 TTTCAACTCAAGAAGATTAATGG + Intronic
915993127 1:160537563-160537585 TTGCTGTTCAAACAGATTAAAGG - Intergenic
916370396 1:164087722-164087744 TTGCCTTTGAAGAAGTTGAAGGG - Intergenic
916662134 1:166932374-166932396 TTGGCTGTGAAGAAGAGTAAAGG + Intronic
916894710 1:169150826-169150848 TTGCCTTGCAAGAAATTCAAAGG - Intronic
917362236 1:174189665-174189687 TTGCTTTTTAAGAAGAGAAAGGG + Intronic
917450883 1:175146544-175146566 TTTCCTTTCCAAAAAATTAAAGG - Intronic
919128406 1:193424783-193424805 TTACTTTCCAGGAAGATTAAAGG - Intergenic
919586956 1:199450947-199450969 TTGTCTTTTAAGAAGAGTTAGGG - Intergenic
921474360 1:215588448-215588470 TAGACTTTCAAGAACATAAAAGG - Intronic
921533309 1:216312065-216312087 TTGCCTTGCAAGAATGTTAAAGG - Intronic
921749720 1:218778210-218778232 TTGCCTTTAAATACGAATAAAGG - Intergenic
924207733 1:241730940-241730962 TTGCCTTTTGAGAAGATTACAGG - Intronic
1063046043 10:2393230-2393252 ATGGCTTTGAAGCAGATTAATGG + Intergenic
1063311328 10:4955455-4955477 TTGCCTTTACAGAAGCTTATTGG + Intronic
1064374209 10:14781160-14781182 TTGCCTTTAAGGAAGAAGAATGG + Intergenic
1068806691 10:61202771-61202793 TTGTCTTTCAAAGAAATTAAGGG - Intergenic
1070578583 10:77700562-77700584 CTTGCTTTCAAGAAAATTAAAGG + Intergenic
1071884973 10:89939850-89939872 TTGCCTTTTAAGAAGACAGAAGG + Intergenic
1072561610 10:96581077-96581099 TTTTCTTTCAGGCAGATTAAAGG - Intronic
1073597675 10:104817209-104817231 TTTCCTTTCCAGGAAATTAAGGG + Intronic
1073711919 10:106052996-106053018 TTGCCTTTGAAGAATTTCAATGG + Intergenic
1074185437 10:111096652-111096674 TTCCCATACAAGAAGAATAAGGG - Intergenic
1074949393 10:118314985-118315007 AGGTCTTTCAAAAAGATTAATGG + Intronic
1077960651 11:7073332-7073354 TTGCCTTACAATAAGTTAAAAGG - Intergenic
1081369699 11:42284674-42284696 TGTCCTTACAAGAAGATGAAGGG - Intergenic
1082945038 11:58749462-58749484 TTGCCTTTCAAGACAATTTAAGG - Intergenic
1083184865 11:61011583-61011605 TTGGCTACCAAGAGGATTAAAGG - Intronic
1084715673 11:70871911-70871933 TTACCTTTCAAGTAGTTCAAAGG - Intronic
1086151836 11:83620141-83620163 CTGCCTTTTAAGACAATTAAGGG + Intronic
1086606003 11:88696815-88696837 TTACCTTTGAATAAGATAAATGG + Intronic
1088079831 11:105897984-105898006 TTGCCTTTTATGAAGTATAAAGG - Intronic
1088863409 11:113822889-113822911 TTGCCCTTCAGGGAAATTAATGG + Intronic
1090444086 11:126748551-126748573 TTGCCCTTCAACAATATTAATGG - Intronic
1091806507 12:3360671-3360693 TAGCATTTCAAGAATATTTATGG - Intergenic
1093106571 12:15094662-15094684 TTTCCTTTTAAGAATATTATTGG + Intergenic
1093356236 12:18171840-18171862 ATGCCATTCTAGAAGATTGAAGG - Intronic
1093853178 12:24065794-24065816 ATGCATTTCATGGAGATTAAGGG - Intergenic
1094782928 12:33813836-33813858 TTGTCTTTCAAGAAGCTTAGTGG + Intergenic
1095267822 12:40180755-40180777 TTGCCTATCATAAATATTAATGG - Intergenic
1095913500 12:47452794-47452816 TTACATTTTAAGAAGATGAAAGG - Intergenic
1097323239 12:58248020-58248042 TTGCCTGTAAAGAAGCTAAAGGG - Intergenic
1098060235 12:66553952-66553974 CTGCCTTTCAAGTAGATTTAGGG - Intronic
1101465997 12:104949956-104949978 GTGCCTTTCAACAAGGTGAATGG + Intronic
1101471515 12:105001067-105001089 TGAGCTTTCCAGAAGATTAAGGG + Intronic
1103728972 12:123013528-123013550 TTGCCATTCCAGAAGATGCAGGG - Intronic
1103921487 12:124401738-124401760 GGGCCTTTCAGGAAGATGAATGG - Intronic
1104214134 12:126719494-126719516 TTACTTTTCAAGAACATTATGGG + Intergenic
1104258833 12:127164261-127164283 TTGCCTTTCCGGAAGATTGTTGG - Intergenic
1107639017 13:42422009-42422031 TTGCTTGTCAAGAAAATTATAGG - Intergenic
1108460221 13:50658462-50658484 TTGCCTTTCAGGAAAGTTCAGGG - Intronic
1110757031 13:79187096-79187118 TTGTCTTCCAAGAAAATAAATGG + Intergenic
1112874379 13:104017537-104017559 TTGCCTTTCAAGACGATAAATGG + Intergenic
1112998937 13:105609510-105609532 TTGCCTATCAAAAAGATCCAGGG - Intergenic
1114382262 14:22219524-22219546 TTGCCATGCAAGAAGATCAATGG - Intergenic
1114392663 14:22326870-22326892 TAACCATTCAAAAAGATTAAAGG + Intergenic
1115169529 14:30488587-30488609 ATGTCTTTCAAGTAGATAAATGG + Intergenic
1116069643 14:40027093-40027115 TTGCTTTTAAAAAAAATTAAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1118657837 14:67972148-67972170 TTGTCTTTTAGGAAGATTTATGG + Intronic
1119114613 14:72007993-72008015 TTACCTTTCATGAAAATGAAAGG + Intronic
1120138407 14:80898577-80898599 TTGTCTTGTAAGAAGATTCAGGG - Intronic
1120359484 14:83479946-83479968 TTCAATTTGAAGAAGATTAAAGG - Intergenic
1120681151 14:87482078-87482100 TTGGATTTCTAGAAGAATAATGG - Intergenic
1120771054 14:88380895-88380917 TTGTCTTTCAGGAACTTTAAGGG + Intergenic
1121195909 14:92071679-92071701 GTGACTTTCAACAATATTAAGGG - Intronic
1121661601 14:95639371-95639393 TTGCTTTTCATGAAGTTTCAGGG + Intergenic
1125470359 15:39996405-39996427 TGGCCTTCCTAGAAAATTAATGG - Intronic
1126268653 15:46786340-46786362 TTGCCTTTAAAGAAAATCAATGG - Intergenic
1126716583 15:51524790-51524812 TTGCCTTTCAAGTTTATTTAAGG - Intronic
1127590576 15:60418355-60418377 TTGTCTTTCAAACAGCTTAAAGG + Intergenic
1127599405 15:60520333-60520355 TTGCATTTCAGGAAGAATGAGGG + Intronic
1128047813 15:64634444-64634466 TTTCCATGAAAGAAGATTAATGG - Intronic
1128293092 15:66494323-66494345 TTTCCTTTCAAGCAGATCACAGG + Exonic
1128298495 15:66545895-66545917 TAGCTTTTCAAGAAATTTAATGG + Intronic
1129137767 15:73569713-73569735 TGGCCTTTCAGGCAGATTTAAGG - Intronic
1130149278 15:81299081-81299103 TTACATTTCAAGAAGGGTAAGGG - Intronic
1130269607 15:82438541-82438563 TTGCCTTCTAAGCAAATTAAAGG - Intronic
1130461949 15:84165839-84165861 TTGCCTTCTAAGCAAATTAAAGG - Intergenic
1130473568 15:84244761-84244783 TTGCCTTCTAAGCAAATTAAAGG - Exonic
1130480982 15:84358825-84358847 TTGCCTTCTAAGCAAATTAAAGG - Intergenic
1130490730 15:84428934-84428956 TTGCCTTCTAAGCAAATTAAAGG + Intergenic
1130502317 15:84507704-84507726 TTGCCTTCTAAGCAAATTAAAGG + Intergenic
1130595851 15:85249358-85249380 TTGCCTTCTAAGCAAATTAAAGG - Intergenic
1131818832 15:96250745-96250767 GTGCCTTTGAAAAATATTAAGGG + Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134307458 16:13046022-13046044 TTGCATTTGGAGAAAATTAATGG - Intronic
1135432990 16:22402583-22402605 TTGATTTGCAAGAAGATAAAAGG - Intronic
1140005561 16:71071302-71071324 TTGCTTGTCAAGAAGCCTAAAGG + Intronic
1140184509 16:72755469-72755491 GGGCCTTTGAAAAAGATTAAGGG - Intergenic
1141333156 16:83130756-83130778 TTGCATTTCAAGAGGGTGAATGG + Intronic
1145775985 17:27529222-27529244 TTAACTTTCTAGAAGATTATGGG + Intronic
1147026903 17:37593922-37593944 ATGCCTGTCAGCAAGATTAAAGG + Intronic
1147545704 17:41399828-41399850 TTTCCTTACAAGACAATTAAAGG + Intergenic
1148095093 17:45047009-45047031 TTGGCCTTCAAGAAAGTTAAAGG + Intronic
1148293378 17:46477012-46477034 TTTCCTTTCAAGCATATCAAGGG + Intergenic
1148315563 17:46694715-46694737 TTTCCTTTCAAGCATATCAAGGG + Intronic
1151004158 17:70414107-70414129 TTGGCTTTTAAGAGGATTCAGGG + Intergenic
1151280601 17:73071386-73071408 TTGCCTTTGAAGAATCTTCAGGG - Intronic
1152687395 17:81701339-81701361 TTGCCTTTCAAGTAAATTCACGG - Intronic
1153241042 18:3031530-3031552 TTGCCATTCAATAAAATGAAAGG - Intergenic
1153453797 18:5259102-5259124 CTGCCTTTCAAGTATATTTAGGG - Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155590329 18:27420230-27420252 ATGCATTTCAAGAAGACTGAAGG - Intergenic
1155846744 18:30717371-30717393 TTGTCTTTCCTGAAAATTAATGG - Intergenic
1156869471 18:41928886-41928908 TTGCTTTTAAAGAAGAATAAAGG + Intergenic
1159375929 18:67593075-67593097 TTGCCTTTCAAGAGGATTTATGG - Intergenic
1159670317 18:71213311-71213333 TTACCTTTTAAGGAGAATAAAGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1161692915 19:5747563-5747585 TTGCTTATAGAGAAGATTAACGG + Intronic
1161902991 19:7133552-7133574 TTGCATTTTAAAATGATTAAAGG - Intronic
1166456492 19:42944968-42944990 TTCCTTTTCAAGGAGATTTATGG - Intronic
1166466278 19:43034234-43034256 TTCCTTTTCAAGGAGATTTATGG - Intronic
1166472427 19:43090305-43090327 TTCCTTTTCAAGGAGATTTATGG - Intronic
1166486032 19:43213345-43213367 TTCCTTTTCAAGGAGATTTATGG - Intronic
1166493186 19:43277293-43277315 TTCCTTTTCAAGGAGATTTATGG - Intergenic
1166924591 19:46258520-46258542 TTGCCTTAAAAGAAGATAAATGG + Intergenic
1168557656 19:57356573-57356595 CTGGCTGTCAAGAAGAGTAAAGG - Exonic
925454726 2:4006495-4006517 TTGGCTTTCAACAAAATTGAAGG - Intergenic
925762796 2:7202477-7202499 GTGCTTTTCATGAAGATTAGGGG - Intergenic
926441554 2:12894170-12894192 TGCCCTTTTAAGAAGAGTAAGGG + Intergenic
929773221 2:44910491-44910513 ATGCATCTCAAGAAGATTACAGG + Intergenic
931015415 2:57973557-57973579 TTACCTCTCAATAAGATGAAAGG + Intronic
932018954 2:68063086-68063108 TTGCCTTTGGAGAAGAGTTAAGG - Intronic
933030040 2:77316844-77316866 TTGCCTTTCAAAAAGAGAATAGG - Intronic
933123768 2:78576781-78576803 CTTCCTCTCAAGAAGATAAATGG - Intergenic
933311309 2:80665108-80665130 TGGCCTTCAAAGAAGATTAATGG - Intergenic
933477019 2:82803756-82803778 CTTCCTTTCAGGAAGATTTAGGG - Intergenic
934881598 2:97986281-97986303 TTGCCTTTGAAGAAAACTATTGG + Intronic
940061192 2:149571335-149571357 TCACCATTCCAGAAGATTAATGG + Intronic
940515184 2:154675458-154675480 TTTCCTTTCAAAAGGATGAAAGG + Intergenic
940822162 2:158367803-158367825 TTGCCTTTCAAAAACATTGAGGG + Intronic
942175154 2:173326243-173326265 TTCCATTTCAAGAATATTATAGG + Intergenic
942828906 2:180215033-180215055 TTGCCCTTCAAGTTGAATAAAGG + Intergenic
943551615 2:189347199-189347221 TTGCTTTTTAAGAAAAGTAAAGG + Intergenic
944293251 2:198032441-198032463 TTGGCTTTCATGAAGACAAAAGG + Intronic
944309838 2:198221605-198221627 TTCCCTTTCTAGAATATTAAGGG + Intronic
945083703 2:206110395-206110417 TTCCCTGCCAAGAAGAATAAAGG - Intergenic
945452006 2:210004657-210004679 TTGGCTTTCAGGAAGCTTATAGG - Intronic
945516639 2:210770630-210770652 TTGGCATTCATGAAGCTTAATGG + Intergenic
945708676 2:213267809-213267831 TTGACTCTCAGGAAGATAAATGG + Intergenic
946097714 2:217290073-217290095 TTGCCTTTCAAGAAGATTAATGG - Intronic
947508731 2:230731119-230731141 CTGCCTTTCAAGCAAGTTAAAGG + Intronic
948708706 2:239811883-239811905 TGGCCTTTCTATAAAATTAAGGG + Intergenic
1169251045 20:4061306-4061328 TTGCTTTTCAAGTATATTACAGG + Intergenic
1170449147 20:16463795-16463817 TTGGCTCTCAACAAAATTAAAGG + Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171079776 20:22167081-22167103 TTGCCTTTTAAGAAAATAAATGG + Intergenic
1181914765 22:26270875-26270897 TTGCCTTTAATGAAGTTTCAAGG - Intronic
1184631685 22:45786238-45786260 ATGCTTTTCAAGAATAGTAATGG - Intronic
949106226 3:203408-203430 ATGTCTTTCAAGAACATCAAGGG - Intronic
949112476 3:278674-278696 GTTCCTTTCAAGAAGTATAATGG + Intronic
950351107 3:12354183-12354205 TCACCTTTCCAGAAGTTTAAAGG + Intronic
953593531 3:44284693-44284715 TTCCCTTTCCAGAAGTTTTATGG + Intronic
953908032 3:46878126-46878148 TTGCCTCTCAGGAAGGTGAAGGG - Intronic
955836607 3:63062396-63062418 TTACCTTCCAAAATGATTAATGG - Intergenic
955904547 3:63793143-63793165 TTGCCCTTGAAGGAGAATAAGGG - Intergenic
956757519 3:72403714-72403736 TTGCATTTAAGGAAGATTAGAGG - Intronic
956849887 3:73219202-73219224 TGGCCTTTCAGGAAGAATCAAGG - Intergenic
959990996 3:112632062-112632084 TAGCCTTAAAACAAGATTAAAGG + Intronic
963351080 3:144151770-144151792 TTGCCTCTCATGAAGCTTGATGG + Intergenic
963571143 3:146997739-146997761 CTGCCTTACAAGAAGTGTAATGG - Intergenic
965056631 3:163725435-163725457 TTGGCTTTGAAGAAGATGGAAGG - Intergenic
966509504 3:180745998-180746020 TTGCCTTTCAAGAAATTAACTGG + Intronic
966542139 3:181103733-181103755 TTGTCTTTGAAGAAGAGTCAAGG + Intergenic
966805719 3:183805820-183805842 TAGGCTCTCAAGAAGCTTAATGG - Intronic
967757805 3:193189820-193189842 TTGACTTTTTTGAAGATTAAAGG - Intergenic
970918698 4:21367488-21367510 TTGCCTTTCAAGAGCTTGAAAGG + Intronic
973053833 4:45629897-45629919 TTGCCTTTCAAGTTTATTTAGGG - Intergenic
973690678 4:53427024-53427046 TTGCCTTTAAAGATGCTAAAAGG - Intronic
974192777 4:58528848-58528870 TTTCCTTTCAAGAAAATTGAAGG - Intergenic
975042191 4:69759864-69759886 TTGACTTTAAGGAATATTAATGG + Intronic
975699155 4:77045626-77045648 TTGCCTTTCCAGAGGCTTCACGG + Intergenic
976492215 4:85684735-85684757 AAGGCTTTCAAGAAGCTTAAGGG - Intronic
976546694 4:86344029-86344051 TTACCTTTCAAGAATATAAAGGG + Intronic
977395517 4:96466413-96466435 TTGCCTTGAAAGATAATTAAAGG - Intergenic
977576057 4:98675225-98675247 TTACCTGTTAAGAAGATTACAGG + Intergenic
977856214 4:101897559-101897581 TTGCCTTTTAAGAAGCTTCCAGG + Intronic
978732242 4:112041861-112041883 TTGCCTTTCCATAAATTTAAAGG - Intergenic
979191405 4:117863488-117863510 ATGCTTTACAAGAAGATTATTGG + Intergenic
980115507 4:128674932-128674954 TTGCTTTACAAGAATATTTATGG - Intergenic
980492997 4:133553347-133553369 TTGTGTTTCAAGACAATTAAAGG + Intergenic
980854357 4:138421699-138421721 TTGCCTTGCAAGCAAAGTAATGG - Intergenic
981739425 4:147986454-147986476 TTGCTTTTCGAGAAAATCAAGGG + Intronic
982086171 4:151838627-151838649 TTTGCTTTCAATAACATTAAAGG + Intergenic
982732079 4:158966873-158966895 GTGACTTTCTAGAAGATTATTGG - Intronic
982991349 4:162279738-162279760 TTGCCTTGGAAGAAGATGATTGG + Intergenic
984172706 4:176380161-176380183 TTGCATTTCAAAAACATTACTGG - Intergenic
984975954 4:185230177-185230199 TTGCCTTTTAAAGTGATTAATGG + Intronic
989280934 5:39642728-39642750 TTCCCTTTCAACAAGGTTCAAGG - Intergenic
989289365 5:39744996-39745018 TTCGCTTTCAAGAATATTTAAGG + Intergenic
990145688 5:52757577-52757599 TTGCCTTTCAATAAATTTACAGG + Intergenic
991277299 5:64864237-64864259 TTGACTTTCAAAAAGAATAATGG - Intronic
992220931 5:74572630-74572652 TTATCTTTCAAGTACATTAACGG - Intergenic
993826768 5:92697743-92697765 TTGCATTTCAACAAGATTTGTGG - Intergenic
993942664 5:94079222-94079244 ATGCATTTTAATAAGATTAAAGG - Intronic
996448576 5:123588998-123589020 TTTGCTTTCAAGTAGATTTATGG + Intronic
996869047 5:128165265-128165287 TTGCCTTACAAAAAATTTAAAGG - Intronic
996944938 5:129055609-129055631 TTGCCTTTCAAGTTTATTCAGGG - Intergenic
998531717 5:142891111-142891133 TTGCGCTACAAGAAGATCAAAGG + Intronic
998838602 5:146229086-146229108 TTGCCTTGCAAGGACATTAAAGG + Intronic
999588425 5:153117137-153117159 TTGTCTTTCAGGGAGACTAAAGG + Intergenic
1000879372 5:166679802-166679824 TTGCCTGTCAAGAAAATTAAAGG - Intergenic
1004478511 6:15997165-15997187 TTGCCTCTGAAGAAGCATAAAGG + Intergenic
1004732998 6:18376516-18376538 GTACCTTTGAAGAAGATTACAGG + Intergenic
1005255795 6:24001686-24001708 TGGCAATTCAGGAAGATTAAAGG + Intergenic
1005573138 6:27166435-27166457 TTGCTTTTCAAGAAGTTAAGAGG - Intergenic
1006660508 6:35638716-35638738 TTGCCTTTAAAGAATATTTGGGG - Intronic
1007974044 6:46082441-46082463 TTGGCTTTCACTAAGATAAATGG - Intergenic
1008202386 6:48607028-48607050 TTGTCTTTCAAGAAGAGCAGAGG - Intergenic
1008645051 6:53505191-53505213 TTTCCATTCAAGATGATTGATGG - Intronic
1008952908 6:57180371-57180393 TTATCTTTAAAGAAGATTGAGGG + Intronic
1009656789 6:66557861-66557883 TTGATTTTAAAGAAGCTTAATGG - Intergenic
1010140011 6:72602877-72602899 TTGCCTTTCAAGTTTATTTAGGG + Intergenic
1011067529 6:83343470-83343492 TCGACTTTCAGGAATATTAAGGG - Intronic
1011081225 6:83491847-83491869 TGTCCTTTCAAGAAGACAAAGGG - Intergenic
1012140191 6:95616975-95616997 TTTTATTTAAAGAAGATTAAGGG - Intergenic
1012758625 6:103266028-103266050 ATGCCTTTGAAGAATGTTAAGGG + Intergenic
1012914946 6:105159927-105159949 TTGCCTTTCAAAATCATAAAGGG - Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014680295 6:124421022-124421044 TAGCTTTTCAAGAAAATTCAGGG + Intronic
1014925524 6:127266439-127266461 TTCCCTTTCAAGAAAAAAAATGG - Intergenic
1016732222 6:147439224-147439246 TGTCATTTCAAGAAGATTCAGGG - Intergenic
1017184235 6:151584791-151584813 TAGCCTTTCAAAAAGTTTAAAGG + Intronic
1018341219 6:162852887-162852909 TTGGCTTTCAAGAAAATTGAAGG - Intronic
1019154524 6:170030137-170030159 GTGCCTTTCAAGCAGGTTACAGG - Intergenic
1020820907 7:12966278-12966300 TTAACCTTCAAGAAAATTAAGGG + Intergenic
1020846959 7:13297944-13297966 TAGCATTTCAAGAAGAGAAAGGG - Intergenic
1021257333 7:18409094-18409116 TTGCCTTGCAAAAAAATTCAAGG + Intronic
1021757280 7:23864795-23864817 TTACCTTTCAAGGAAATGAAGGG - Intergenic
1022211482 7:28214482-28214504 TTGGGTTTCAAGAATATTTATGG - Intergenic
1024501873 7:50118715-50118737 TGACCTTTCCAGAAGACTAAGGG - Intronic
1030188101 7:106783377-106783399 TTTGCTTTCAATAAAATTAAAGG - Intergenic
1031417216 7:121508732-121508754 TGGCCTTTGAAGAAGAATAGCGG - Intergenic
1033394163 7:140957498-140957520 TTACCTCTCAATAAGATTTAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034003530 7:147443115-147443137 CTGCCTTTCAAGATTATTTAGGG + Intronic
1037535524 8:19819843-19819865 TATCCTTTAAAGAAGCTTAAAGG - Intronic
1038672365 8:29592500-29592522 TTGCCTTTGGAAACGATTAATGG + Intergenic
1038865150 8:31431486-31431508 TAGCTTTTAAAGAAGATGAAGGG - Intergenic
1039208415 8:35183536-35183558 TTGCCATGCAAGAAAATTCAGGG - Intergenic
1040713276 8:50215695-50215717 TCTCCTTTCAAAAAGATTATAGG + Intronic
1041463216 8:58133833-58133855 TTTCCTTTCAAGGAGCTTAATGG + Intronic
1042714523 8:71758204-71758226 TTGCGCCTCAAGAAGATAAAGGG + Intergenic
1043374346 8:79631683-79631705 TTGTCTTTGAAGAAGATCACAGG + Intronic
1043687167 8:83101288-83101310 TTGCCTTTGAAGTAAATTAGAGG + Intergenic
1043760679 8:84063692-84063714 GTGCCTTTCAAGATTATTTAGGG + Intergenic
1044802623 8:95972751-95972773 TTGCCTTTAAAGAAGTATTAAGG - Intergenic
1047041408 8:121000487-121000509 TTGGCTTTCAACAAAATCAAAGG + Intergenic
1047265840 8:123307962-123307984 TTGCCTTGCAAGAACAGTCAAGG - Intergenic
1047843260 8:128777543-128777565 TTCCCTTTCTATAAGATCAAAGG + Intergenic
1048428700 8:134347072-134347094 TTGCCTTTTGAGATGATCAAAGG - Intergenic
1051977154 9:22964792-22964814 TTTACTTTTAACAAGATTAATGG - Intergenic
1052395725 9:27935672-27935694 TTGCCTTTCGTGAAGGTGAAAGG - Intergenic
1055865799 9:80811770-80811792 TAGTCTTTCAAGTAGATCAAAGG + Intergenic
1056316619 9:85396473-85396495 TTTCCTTACAAGAACAATAATGG + Intergenic
1056559547 9:87718245-87718267 ATTTATTTCAAGAAGATTAAAGG - Intergenic
1057582285 9:96297989-96298011 TTTCATTTCAAGGACATTAATGG - Intronic
1057587970 9:96346627-96346649 TTGACATTGAAGAAGATTCAGGG - Intronic
1057960520 9:99451720-99451742 TTGGCTTTCAATACTATTAAGGG - Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058249157 9:102669485-102669507 TTGCCTTTCAAGTTTATTTAGGG + Intergenic
1058269992 9:102959915-102959937 TTGGCTTTACAGAAGATTACGGG - Intergenic
1058590790 9:106563036-106563058 TTGCCATCCAAGCAGATTAAAGG - Intergenic
1059221129 9:112619795-112619817 TTGCCTATAAAGAAGGTAAAAGG + Intronic
1060126201 9:121049335-121049357 TCGTCTTTCAAAAAGAATAAAGG + Intronic
1061522523 9:131127836-131127858 TTGACTCCCAAGAAGATTAATGG + Intronic
1061606700 9:131716266-131716288 TGGCTTTTCAAGAAGCTTCATGG + Intronic
1062418893 9:136469445-136469467 TGGCCTTTCAAGAATCTTGAAGG - Intronic
1185877344 X:3712222-3712244 TTGGCTGTCAAGAAAATAAATGG - Intronic
1187114464 X:16334863-16334885 TTGCCTTTCAAGAGGCTTTCAGG - Intergenic
1187348080 X:18485457-18485479 CTGCCTTACAAGAAGTTTGAAGG - Intronic
1187744228 X:22390657-22390679 TGTCATTTCATGAAGATTAAGGG - Intergenic
1188802546 X:34549771-34549793 ATCCCTTCAAAGAAGATTAAAGG - Intergenic
1189821928 X:44877400-44877422 TTACATTACCAGAAGATTAAGGG - Intronic
1189996994 X:46648358-46648380 GTGCCCTTCAGGAAGCTTAAGGG + Intronic
1191796966 X:65031802-65031824 TTGTCTTTCAGGAAGACTAGAGG + Intronic
1192394987 X:70771505-70771527 TTGCATTTAAAAAAGATTAATGG - Intronic
1192726271 X:73756187-73756209 TTGCATTTCCTGATGATTAATGG + Intergenic
1193972324 X:88070108-88070130 CTTCCATTCAAGAAGCTTAAAGG - Intergenic
1194652881 X:96536422-96536444 TTCCCTTTCAAGAATATGTATGG + Intergenic
1194711214 X:97238654-97238676 TGGCCTTTAAAGAAAATAAACGG - Intronic
1194870592 X:99126581-99126603 TGGCCTTTCAATCAGAATAAGGG + Intergenic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1195564548 X:106325644-106325666 ATGCCTTCTAAGAAGTTTAAGGG - Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196508497 X:116477200-116477222 TTGCCTTTCAAGTTTATTTAGGG + Intergenic
1196524318 X:116713719-116713741 TTGCCTTACAAGAGGACTTAAGG + Intergenic
1196804303 X:119571029-119571051 CTTCCTTTCAAGAAAACTAAGGG - Intergenic
1197610989 X:128637882-128637904 TTCCCTTTCAAGATGTTTGATGG - Intergenic
1200407576 Y:2829125-2829147 ATGCCTTTCAGGAAGAGTGAAGG + Intergenic
1200882719 Y:8235348-8235370 TTCCCTTTCAATCAGATTATAGG - Intergenic
1202593027 Y:26507384-26507406 TTCCCATTCAAGGACATTAATGG + Intergenic