ID: 946099351

View in Genome Browser
Species Human (GRCh38)
Location 2:217305902-217305924
Sequence CTGGTCAAGGGTTACACCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946099351_946099358 21 Left 946099351 2:217305902-217305924 CCTACGGTGTAACCCTTGACCAG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 946099358 2:217305946-217305968 TTTTTGTCCCCGCAGGTGAATGG 0: 1
1: 0
2: 0
3: 12
4: 97
946099351_946099357 14 Left 946099351 2:217305902-217305924 CCTACGGTGTAACCCTTGACCAG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 946099357 2:217305939-217305961 TACTGTCTTTTTGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946099351 Original CRISPR CTGGTCAAGGGTTACACCGT AGG (reversed) Intronic
907460758 1:54604135-54604157 CTTGTCTAGGGTCACACAGTGGG + Intronic
907626430 1:56034971-56034993 CTGGCCAAGGGTAACCCCATGGG + Intergenic
907654579 1:56329283-56329305 CTTGTCAAAGGTTACAGGGTTGG - Intergenic
908823866 1:68115110-68115132 CCGGTCATGGGTTGCACCTTGGG + Intronic
1065415133 10:25476791-25476813 CTGGTGAAGGGGTACAACATGGG - Intronic
1072001055 10:91196050-91196072 CTGGTCAAGTGTTGCCCCATGGG + Intronic
1072543450 10:96415976-96415998 CAGGTCAAGGGTTACATGTTGGG - Intronic
1078659499 11:13275945-13275967 CTGGCCAAAGGTCACACAGTAGG - Intergenic
1089282346 11:117383041-117383063 CTGGCCAAGGGTTAGAGTGTAGG + Intronic
1099047090 12:77734798-77734820 CTGGTCAAGGTTAACACATTAGG - Intergenic
1102563922 12:113782266-113782288 CTTGCCAAGGGTCACACCATGGG + Intergenic
1113419934 13:110163424-110163446 CTGGTCAAGGGTAATTACGTTGG + Intronic
1122974766 14:105166513-105166535 CTGGTCAAGGGATACTCGGCGGG + Intronic
1125370616 15:38972393-38972415 CTGGCCAAGGGTTAGACATTTGG - Intergenic
1139246675 16:65451616-65451638 CGGGTCTAGGGTTACATCTTTGG - Intergenic
1141343761 16:83227204-83227226 GTGGCCAAGGATTACACAGTTGG + Intronic
1161325525 19:3661946-3661968 CTGGGCATCGGCTACACCGTGGG - Exonic
1165487614 19:36104927-36104949 CTGGCCAGGGGGTACAGCGTCGG - Exonic
928911755 2:36429057-36429079 ATGGACAAGGGCTGCACCGTAGG + Intronic
930066731 2:47333313-47333335 ATGCTCAAGGATTACTCCGTAGG - Intergenic
933319431 2:80755105-80755127 CTGGTAAAGGATAACACTGTTGG - Intergenic
938957911 2:136315597-136315619 CTGGTCTAGGGTTGCCCCGAAGG - Intergenic
939013157 2:136871105-136871127 CTGGTGAAGTGTGACACTGTCGG + Intronic
945081798 2:206093498-206093520 CTTGCCCAGGGTTACACAGTAGG - Intergenic
946099351 2:217305902-217305924 CTGGTCAAGGGTTACACCGTAGG - Intronic
1169272377 20:4210550-4210572 CTGGTCATGAGTTGCACCCTGGG + Intergenic
1173986228 20:47263671-47263693 CTGGCCCAGGGTTACACAGCAGG - Intronic
1184987610 22:48146196-48146218 CTGGTCAAGGGCTACTAAGTTGG - Intergenic
1185302854 22:50091683-50091705 CTAGTCCAGGGTTACACCAATGG + Intronic
952133990 3:30396551-30396573 TTGGTCAAGGGTTGCACCGTTGG + Intergenic
953557674 3:43959772-43959794 CTGGCAAAGGTTTACACAGTTGG - Intergenic
953912090 3:46898393-46898415 CTGGGCATGATTTACACCGTGGG + Exonic
955324425 3:57999085-57999107 CTGGCCATGGGTTCCACCTTGGG + Intergenic
962708554 3:138067475-138067497 CTGGAGAAGGGCTACACCGGTGG + Intronic
962927609 3:140009898-140009920 CTGGACAAGGGCAACAGCGTGGG - Intronic
964358752 3:155872169-155872191 CTGCTCAAGGGTCACATCTTAGG + Intronic
967851285 3:194084388-194084410 TTGGTCAAGGGTAGCTCCGTGGG + Intergenic
972390073 4:38605999-38606021 CTGGTCTCTGGTTACACCCTAGG + Intergenic
975732706 4:77353427-77353449 CTGGTCAACTGTTACATTGTAGG + Intronic
978990953 4:115081460-115081482 CTTTTCAAGGGTCACACAGTAGG - Intronic
985177930 4:187222491-187222513 CTGGTCAAGTGCAACATCGTTGG - Intergenic
993021326 5:82595126-82595148 CTGGTCAAGGGTTGCCCCACTGG + Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
998818313 5:146035507-146035529 CTTGCCCAGGGTTACACGGTCGG + Intronic
1012545525 6:100414653-100414675 ATGGTCAAGGATTACACATTTGG + Intronic
1024029116 7:45441972-45441994 CTGGTCAAGGGTCACCCCATGGG - Intergenic
1031075000 7:117203263-117203285 CTTGTTCAGGGTTACACAGTTGG - Intronic
1031926891 7:127647545-127647567 CTGGTCAAGGTATACAGTGTTGG + Intergenic
1043418730 8:80077480-80077502 TTGGTCAAGTGTTTTACCGTGGG - Intronic
1045883623 8:107069972-107069994 CTTGTCAAAGGTTACACAGTTGG + Intergenic
1047434600 8:124825704-124825726 CTTGTCAAGGGTCACACAGTTGG + Intergenic
1049923769 9:389573-389595 CTGGTCCAGGGTTACACTTTAGG - Intronic
1050952713 9:11618228-11618250 CTGGTAAAGGGTAACAACGTAGG + Intergenic
1062635571 9:137488827-137488849 CTGGTCAGGGGGTGCACAGTTGG - Intronic
1062635580 9:137488862-137488884 CTGGTTAGGGGGTACACAGTTGG - Intronic
1062635599 9:137488962-137488984 CTGGTTAGGGGGTACACAGTTGG - Intronic
1062635619 9:137489062-137489084 CTGGTCAGGGGGTGCACAGTTGG - Intronic
1200374458 X:155765336-155765358 CTTGTCCAAGGTTACACAGTTGG - Intergenic